ID: 1057772859

View in Genome Browser
Species Human (GRCh38)
Location 9:97983499-97983521
Sequence TCCCCCCTCCGCCCCCGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 0, 2: 5, 3: 87, 4: 628}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057772850_1057772859 16 Left 1057772850 9:97983460-97983482 CCCTTCCGACGGCCCTCGCTGCG 0: 1
1: 0
2: 1
3: 2
4: 28
Right 1057772859 9:97983499-97983521 TCCCCCCTCCGCCCCCGCCGCGG 0: 1
1: 0
2: 5
3: 87
4: 628
1057772855_1057772859 4 Left 1057772855 9:97983472-97983494 CCCTCGCTGCGCAAGCCGGGACG 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1057772859 9:97983499-97983521 TCCCCCCTCCGCCCCCGCCGCGG 0: 1
1: 0
2: 5
3: 87
4: 628
1057772851_1057772859 15 Left 1057772851 9:97983461-97983483 CCTTCCGACGGCCCTCGCTGCGC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1057772859 9:97983499-97983521 TCCCCCCTCCGCCCCCGCCGCGG 0: 1
1: 0
2: 5
3: 87
4: 628
1057772856_1057772859 3 Left 1057772856 9:97983473-97983495 CCTCGCTGCGCAAGCCGGGACGC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1057772859 9:97983499-97983521 TCCCCCCTCCGCCCCCGCCGCGG 0: 1
1: 0
2: 5
3: 87
4: 628
1057772847_1057772859 30 Left 1057772847 9:97983446-97983468 CCGCCGCTAGCAAACCCTTCCGA 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1057772859 9:97983499-97983521 TCCCCCCTCCGCCCCCGCCGCGG 0: 1
1: 0
2: 5
3: 87
4: 628
1057772852_1057772859 11 Left 1057772852 9:97983465-97983487 CCGACGGCCCTCGCTGCGCAAGC 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1057772859 9:97983499-97983521 TCCCCCCTCCGCCCCCGCCGCGG 0: 1
1: 0
2: 5
3: 87
4: 628
1057772848_1057772859 27 Left 1057772848 9:97983449-97983471 CCGCTAGCAAACCCTTCCGACGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1057772859 9:97983499-97983521 TCCCCCCTCCGCCCCCGCCGCGG 0: 1
1: 0
2: 5
3: 87
4: 628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057772859 Original CRISPR TCCCCCCTCCGCCCCCGCCG CGG Exonic