ID: 1057773237

View in Genome Browser
Species Human (GRCh38)
Location 9:97984702-97984724
Sequence GCCAAGCCCCGGCGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057773237_1057773254 30 Left 1057773237 9:97984702-97984724 CCCCCGCCCCGCCGGGGCTTGGC 0: 1
1: 0
2: 1
3: 28
4: 294
Right 1057773254 9:97984755-97984777 GCCGCCGACTCATCCCGTCGCGG No data
1057773237_1057773247 -10 Left 1057773237 9:97984702-97984724 CCCCCGCCCCGCCGGGGCTTGGC 0: 1
1: 0
2: 1
3: 28
4: 294
Right 1057773247 9:97984715-97984737 GGGGCTTGGCTCCCACTGGCGGG No data
1057773237_1057773250 5 Left 1057773237 9:97984702-97984724 CCCCCGCCCCGCCGGGGCTTGGC 0: 1
1: 0
2: 1
3: 28
4: 294
Right 1057773250 9:97984730-97984752 CTGGCGGGAGCCGCGCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057773237 Original CRISPR GCCAAGCCCCGGCGGGGCGG GGG (reversed) Intronic
900117031 1:1033315-1033337 GCCCCGCCCTGGCGGGGCGTAGG - Intronic
901373260 1:8818046-8818068 GCCCAGCCCGGGGGGCGCGGGGG - Intergenic
901637732 1:10678127-10678149 GCCCAGCCCAGGAGAGGCGGCGG + Intronic
902323647 1:15684496-15684518 GGGAAGCGGCGGCGGGGCGGCGG + Exonic
902409998 1:16206915-16206937 GCGGGGACCCGGCGGGGCGGGGG - Intronic
902586197 1:17439815-17439837 GGCCAGGCCGGGCGGGGCGGGGG - Intergenic
903069053 1:20717742-20717764 GGGAGTCCCCGGCGGGGCGGGGG - Exonic
903331897 1:22600817-22600839 GCCAAGCCCTGGCAGGTCCGCGG + Intronic
903578524 1:24353978-24354000 TTCAAGCCCCGGAGGGGTGGTGG - Intronic
903986947 1:27235110-27235132 GCCAGGCCTCGCCGGGGCGGAGG + Intronic
904343199 1:29851450-29851472 GCGAAGCTCCTGCAGGGCGGTGG - Intergenic
904617241 1:31756482-31756504 GCCTAGCCCCGAGGAGGCGGTGG - Exonic
904931112 1:34088193-34088215 GCCAAGCCCTGGGGAGCCGGAGG - Intronic
905912068 1:41662088-41662110 GCCAGGCCGCGGCGGGGGCGCGG + Intronic
906034131 1:42740341-42740363 GCCCAGCCCCCTGGGGGCGGAGG + Intergenic
906128502 1:43442136-43442158 GGCATGGCCCGGGGGGGCGGGGG + Intronic
906520933 1:46466552-46466574 TCAAAGCGCCGGCGGCGCGGGGG - Intergenic
911059893 1:93738747-93738769 GCCAAGACAGGGTGGGGCGGGGG + Intronic
913047923 1:115089491-115089513 GGCAGGCTCCGGCGGGGAGGGGG + Intronic
913671087 1:121097765-121097787 GCCAAGCCTCCGCGGAGAGGAGG + Intergenic
914293619 1:146298088-146298110 CCCACTCCCCGGCGGGGTGGCGG + Intergenic
914316125 1:146513515-146513537 GCCGAGTCGGGGCGGGGCGGGGG + Intergenic
914498230 1:148219846-148219868 GCCGAGTCGGGGCGGGGCGGGGG - Intergenic
914554663 1:148748871-148748893 CCCACTCCCCGGCGGGGTGGCGG + Intergenic
915238271 1:154501839-154501861 GCCAAGCCCGGGGGCGGCGGCGG - Exonic
916108600 1:161447796-161447818 GCCTTGCCCCGGTGGGGCGCGGG - Intergenic
916110188 1:161455177-161455199 GCCTTGCCCCGGTGGGGCGCGGG - Intergenic
916111773 1:161462587-161462609 GCCTTGCCCCGGTGGGGCGCGGG - Intergenic
916113360 1:161469968-161469990 GCCTTGCCCCGGTGGGGCGCGGG - Intergenic
916483406 1:165235674-165235696 GCAAAGCCCCGCGCGGGCGGAGG - Intronic
918487492 1:185045315-185045337 GCCAGCCCAGGGCGGGGCGGTGG + Intergenic
921923096 1:220690310-220690332 CCCCAGCCCGGACGGGGCGGGGG - Exonic
922572511 1:226642455-226642477 GCCAACCCCAGGCTGGGTGGTGG - Intronic
922603002 1:226870968-226870990 GCCGAGCCCCGGCTGGGGGTGGG + Intronic
922797879 1:228350114-228350136 GCCCAGCTGCGGCGGGGTGGTGG + Intronic
923400775 1:233614072-233614094 GCCAGGCCCGGGCGGGGGCGGGG + Exonic
1063193611 10:3719597-3719619 GCCAAGCCCCTGGCGGGAGGAGG + Intergenic
1065993125 10:31031939-31031961 GCCCCGCCCCGGCGCCGCGGCGG + Intergenic
1067438460 10:46294813-46294835 GCCCAGCCCAGGAGGGGAGGAGG - Intronic
1067474469 10:46556753-46556775 CCCGGGCCGCGGCGGGGCGGTGG - Intergenic
1070175833 10:73968437-73968459 GCCAAACCACTGAGGGGCGGGGG + Intergenic
1070767967 10:79067341-79067363 GCGCAGCCCCGGCCGGGCTGCGG - Intergenic
1075801867 10:125159449-125159471 CCAAAGTCGCGGCGGGGCGGGGG - Intronic
1076119882 10:127927184-127927206 CCCAACCCCCGGGGGGGTGGGGG - Intronic
1077056798 11:597803-597825 GCCTGGCCCTGGCGGGGTGGGGG + Intronic
1077277175 11:1717958-1717980 CCCAAGCCCCAGGGGGGCGGCGG + Intergenic
1077376889 11:2209392-2209414 TCCCAGCCCAGGCTGGGCGGGGG + Intergenic
1077454754 11:2671859-2671881 GCCAAGCCCTGGAGAGGAGGTGG + Intronic
1077462469 11:2717528-2717550 GCCAGGCCCTGGTGGGGCAGAGG - Intronic
1078341353 11:10499822-10499844 GCCAAGCCCCTGTGTGGTGGTGG - Intronic
1078616452 11:12870557-12870579 CCCAACCCCGGGGGGGGCGGGGG - Intronic
1080386528 11:31814052-31814074 TCCAAGACGCGGGGGGGCGGCGG + Intronic
1081549131 11:44095999-44096021 TCACAGCCCCGGCGGGGCTGGGG - Intronic
1081851508 11:46277974-46277996 GCGAAGCCCCGGGGGAGGGGCGG - Exonic
1082028686 11:47589839-47589861 CCCGAGGCCCGGCGGGGCGGCGG + Exonic
1083171062 11:60924399-60924421 ACTAGGACCCGGCGGGGCGGAGG + Intergenic
1083680819 11:64351164-64351186 GCCAGGGCCCCGCGGGGCTGGGG + Exonic
1083878055 11:65535092-65535114 GCCAGGCCCAGGCTGGGAGGTGG + Intronic
1083970326 11:66070469-66070491 GCCATGGCCCGGCTAGGCGGGGG - Exonic
1084068467 11:66718909-66718931 GGCCAGGCCCTGCGGGGCGGCGG + Intronic
1084968154 11:72755151-72755173 CCCCTGACCCGGCGGGGCGGCGG - Intronic
1084973018 11:72781670-72781692 GGCGGGCCCCGGCGGAGCGGCGG - Intronic
1085405123 11:76257138-76257160 CACGAGCCCCGGCGGGGAGGAGG - Intergenic
1086449950 11:86906137-86906159 GCCAGGGCCTGGCGGGGCCGGGG + Intronic
1086455354 11:86955066-86955088 GCCATGGCCTGGCGGGGCGCAGG - Exonic
1089280878 11:117373545-117373567 GCCCAGCCCCAGTGGGGCGGAGG + Intronic
1089339084 11:117745424-117745446 GCCAAGACAGGGTGGGGCGGGGG + Intronic
1091000894 11:131910426-131910448 GCCTGGGCCCGGCGCGGCGGGGG + Intronic
1095440818 12:42237833-42237855 GCCGAGGGCCCGCGGGGCGGGGG - Intronic
1096106332 12:48998616-48998638 GCCCAGGGCCGGCGGGGCGGCGG + Exonic
1100309168 12:93378241-93378263 CCCACTCCCCGGCGGGGTGGCGG + Exonic
1102146181 12:110656578-110656600 GCAAGGCCCTGGCGGGGGGGTGG - Intronic
1102247142 12:111362787-111362809 GCCGAGGCCCGGCGGCGAGGCGG + Exonic
1103627101 12:122227557-122227579 TCCTAGCCCAGGCGGGGCGCTGG + Intronic
1103856212 12:123972799-123972821 GCTAGGCGCCGGCGCGGCGGCGG + Exonic
1103856346 12:123973171-123973193 GGGAAGCCCCGGGGGAGCGGGGG - Exonic
1103894478 12:124264042-124264064 ACCAAGGCCTGTCGGGGCGGGGG - Intronic
1103919395 12:124391490-124391512 CCCAAGCCCTGGCGGGGGGGGGG + Intronic
1104289507 12:127455393-127455415 CCCGAGGCCCTGCGGGGCGGGGG - Intergenic
1104707116 12:130955687-130955709 GCCAAGCTCTGGTGGGGCGGGGG - Intronic
1104891104 12:132140597-132140619 GTGAGGCCCCGGCTGGGCGGGGG - Intronic
1110596575 13:77326722-77326744 GCCGAGCCCCGAGGAGGCGGCGG + Intronic
1114216910 14:20663952-20663974 GCCAAGCCCCAGTTGGGCGCTGG - Intergenic
1114474083 14:22981968-22981990 GGCAAGGCCCGGGTGGGCGGCGG + Exonic
1116828360 14:49693443-49693465 GTCAAGCCCTGGCGCGGCTGTGG - Intronic
1117736445 14:58773365-58773387 GCCATTCCCTGGAGGGGCGGGGG + Intergenic
1118905296 14:70019075-70019097 GCCAAGGCCTGGTGGGGCTGAGG + Intronic
1119781304 14:77278244-77278266 CCCAAGCCCAGGTGGGGCCGTGG - Intronic
1120198606 14:81514167-81514189 CCAAAGCCCCATCGGGGCGGGGG + Intronic
1121569501 14:94936829-94936851 GCCAAGGCCAGGCCGGGCCGAGG - Intergenic
1121762839 14:96460551-96460573 GCCATGCCCCGGCGGTGCAGTGG - Intronic
1122228302 14:100292307-100292329 GGCAGGCCCCGCAGGGGCGGCGG + Exonic
1122271176 14:100569003-100569025 GCCCTCGCCCGGCGGGGCGGTGG - Intronic
1122620743 14:103056659-103056681 GCGAGGGCCCGGCGGGGGGGAGG + Intronic
1122882552 14:104696627-104696649 GCCCAGGCCCTGCAGGGCGGTGG - Intronic
1122959852 14:105089455-105089477 GCCCAGCGCCGTCGGGGTGGGGG - Intergenic
1123037996 14:105479081-105479103 GCCGAGCCCCGGGGCGGGGGCGG - Intronic
1124346335 15:28923870-28923892 GAGGAGCCCCGGGGGGGCGGTGG - Intronic
1124439266 15:29674997-29675019 CCCAGGCCCCGGCGGGGGAGGGG - Intergenic
1124696910 15:31870860-31870882 GCCCGGCCCCGGAGGGGCGGGGG - Intergenic
1125861997 15:43008355-43008377 GCCAAGCCCAGGCGCTGCCGCGG + Intronic
1125874702 15:43133779-43133801 GCCGCGCCCCGGCGGGCGGGCGG + Exonic
1126150826 15:45522558-45522580 GCGGAGCCCCGGCGGAGCGTCGG - Intronic
1127916769 15:63461275-63461297 GCCCAGCCCCAGCGGGTCAGGGG + Intergenic
1129799794 15:78405532-78405554 TTCCAGCCCCGGCGGGGCTGTGG - Intergenic
1130520567 15:84658133-84658155 GCCATGGCCCGGCGGGCGGGGGG - Exonic
1131055910 15:89374878-89374900 GCCAGGGCCGGGCGGGGAGGAGG - Intergenic
1132870096 16:2112113-2112135 GCCAGGCCCGGGGAGGGCGGGGG + Intronic
1133270659 16:4609585-4609607 GCCAGGACCCCGTGGGGCGGGGG - Exonic
1133316968 16:4890914-4890936 GCCATGGCCTGGCGGGGCAGAGG + Exonic
1133325088 16:4937260-4937282 TCCAAGCCCCGCCCGCGCGGTGG - Intronic
1134085851 16:11357002-11357024 GCCAAGCCCAGGTGGGGGTGGGG + Intergenic
1136381975 16:29900106-29900128 GGCCCGCCCCGGCGGGGCGAGGG - Intergenic
1136554028 16:30997401-30997423 GCCAAGCACCGGCGGGGGCGTGG - Intronic
1136625919 16:31462226-31462248 GCCAAGGCCAGGCGGTGCTGGGG - Exonic
1137251267 16:46742732-46742754 GCCCAGCACCGGCGTGGGGGAGG + Intronic
1137604598 16:49779149-49779171 GCCAAGCCAGGGCTGGGCTGTGG + Intronic
1141686081 16:85570758-85570780 GCCAGGCCCTGGAGGGGCTGAGG + Intergenic
1141862927 16:86730266-86730288 CCCAAGCCCGGGTGGGGCTGGGG - Intergenic
1141945865 16:87310019-87310041 TCCAAGCCCAGGCGGGGAGTTGG + Intronic
1142079635 16:88142216-88142238 TGCAAGACCCGGCTGGGCGGGGG + Intergenic
1142151161 16:88513094-88513116 GCCAAGCCCTGCAGGGGCAGGGG + Intronic
1142384377 16:89753430-89753452 GACCAGCCCCGGAGGGTCGGTGG - Intronic
1144735342 17:17552537-17552559 CCCAAGCCCCATCAGGGCGGTGG + Intronic
1145884231 17:28371583-28371605 GCCACGCCCCGGAGGAGCAGTGG - Intronic
1145884258 17:28371660-28371682 GCCACGCCCCGGAGGAGCAGCGG - Exonic
1146793199 17:35764475-35764497 GCACAGCCCCCGCGGCGCGGCGG - Exonic
1147157031 17:38549132-38549154 GGGAAGCTCCGGCGGGGAGGGGG + Exonic
1147315532 17:39618296-39618318 GGCAAGCGCGGGCGAGGCGGGGG - Intergenic
1148568347 17:48646884-48646906 GCCGAGCCCCGCCCGGGCGGAGG - Intergenic
1148846908 17:50534774-50534796 GCCCAGCACTGGCGGGGCTGGGG + Intronic
1149678635 17:58488271-58488293 GCCCCGGCCCGGCGGGGCGATGG - Exonic
1149994521 17:61399739-61399761 GCCAAGCTCCGGCCGGGAGGGGG - Intergenic
1150423250 17:65056808-65056830 GCCCGGCCCCGGAGGGGCGGTGG + Exonic
1150648047 17:66992150-66992172 GCCAAGCTCCTGGGGGGGGGGGG + Intronic
1150692388 17:67377533-67377555 GCCGAGCCCCGGAGCGGCGCGGG + Intronic
1151559167 17:74861551-74861573 GCCCGGGCGCGGCGGGGCGGGGG + Intergenic
1151725122 17:75878906-75878928 GCCCAGCCCCTGCGGAGCGCTGG - Intergenic
1152074756 17:78152044-78152066 GCCAAGCCCAGGCTGGGCACGGG - Intronic
1152301307 17:79496571-79496593 GCCAAGCCCCGCCAGGGCCTGGG - Intronic
1152577592 17:81149631-81149653 GCCAAGCCCAGGGTGGGCTGGGG - Intronic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1152744273 17:82031860-82031882 GCGCAGCCGGGGCGGGGCGGGGG + Intronic
1153805506 18:8705985-8706007 GACAAGCCCCCGCCGGGCGCCGG + Intronic
1154160903 18:11980769-11980791 GCCCAGCCCCGGAGGTGCCGGGG - Intergenic
1156488991 18:37485399-37485421 CCCGAGCTCAGGCGGGGCGGCGG + Intronic
1157482809 18:48066341-48066363 GCCAAGCCCTGGGGGGGCGGAGG + Intronic
1158836324 18:61334358-61334380 GCCGAGCTCCGGCGGGGGCGCGG - Intronic
1159369935 18:67516770-67516792 GGCAAGCGGGGGCGGGGCGGAGG + Exonic
1160567974 18:79798605-79798627 GCCGCGCCCCGGCTGGTCGGAGG - Intergenic
1160706292 19:531733-531755 GGCAAGCGCCGGTGGGGCGGCGG + Exonic
1160734449 19:655869-655891 ACCAGGCCACGGCGGGGGGGAGG + Intronic
1160740568 19:683578-683600 GACAAGCCCGGGAGGGGCTGAGG + Intergenic
1160744738 19:705543-705565 GCCAGACCCAGGCAGGGCGGTGG - Intergenic
1160793949 19:935247-935269 GCCAGGCCGCGGCGGGGGGCCGG + Intronic
1160870621 19:1276139-1276161 GTCAGGCCCTGGCGGGGCGAGGG + Intronic
1160944681 19:1636016-1636038 GCCAGACCCAGGCAGGGCGGTGG - Intronic
1160992351 19:1864864-1864886 TCCCAGCTCCGGCGGGGCGGCGG + Intergenic
1161376391 19:3941200-3941222 GCCTTGCCCCGGGCGGGCGGGGG + Intronic
1161702368 19:5802514-5802536 CCCCAGCCGCGGCGGGGAGGGGG + Intergenic
1161775985 19:6262399-6262421 GCCAAGCCCCTGTGAGGAGGTGG - Intronic
1162118243 19:8445196-8445218 GCCTAGCCCCGGCGCGGCCTCGG + Intronic
1163610940 19:18301254-18301276 GCCAGGCCCAGGCTGGGAGGCGG + Intergenic
1163666689 19:18606863-18606885 GCCCGGCCCCGGGGGGGCGGCGG + Intronic
1163819471 19:19487733-19487755 GCCAGGCCCCAGGAGGGCGGGGG + Intronic
1164160639 19:22623612-22623634 GCCCAGCCCCTGCCCGGCGGTGG + Intergenic
1164179548 19:22807139-22807161 GCCCAGCCCCTGCCCGGCGGTGG - Intergenic
1164658650 19:29942729-29942751 GCCTAGGCCACGCGGGGCGGCGG - Intronic
1165079991 19:33301665-33301687 GCCAGGGCCCGGCAGGCCGGCGG + Exonic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1165305422 19:35000252-35000274 GCCGTGACGCGGCGGGGCGGGGG + Intronic
1167105979 19:47430044-47430066 CCCTAGCCCCGGGCGGGCGGTGG + Exonic
1167258149 19:48443145-48443167 GCCAGGCGCGGGCGGCGCGGGGG + Exonic
1167369497 19:49072209-49072231 GCGAAGGCGCGGCGGGGCAGGGG + Exonic
1167594257 19:50418881-50418903 GCCCAGCCCCTGCCGGGGGGAGG - Intronic
1167638426 19:50667892-50667914 GGCCAGCCCCAGCGGGGAGGCGG + Exonic
1168241792 19:55092411-55092433 GCAAAGCCCCGACGGAGGGGTGG + Intronic
929501163 2:42493063-42493085 GGCGCGCCCCGGCGGGGCCGAGG - Exonic
929941889 2:46340379-46340401 GCTCAGCCCCAGCGGAGCGGAGG + Intronic
930022082 2:47007672-47007694 GCCAGGCCCTGGCAGGGAGGGGG + Intronic
930035492 2:47082884-47082906 GCCCAGCCCAGGAGGGGCTGAGG + Intronic
932314132 2:70768323-70768345 GCGAGGCCGCTGCGGGGCGGTGG - Intergenic
932591522 2:73070794-73070816 GCCAGTCCCCGGCGGCGCGGGGG + Intronic
933805483 2:85995864-85995886 GCCAAGCCCTGGAGGAGCGCTGG + Intergenic
933907934 2:86913948-86913970 GCCTCGACCTGGCGGGGCGGTGG + Intronic
935011572 2:99141241-99141263 GCCCCGCCCCGGCGGATCGGAGG + Intronic
935581348 2:104758444-104758466 TCCAGGCCCCGGCAGGGAGGAGG - Intergenic
936388777 2:112054544-112054566 GGCAAGACCCGGCGGGGAGGCGG - Intergenic
936427446 2:112433333-112433355 GCCTCGACCCGGCCGGGCGGCGG - Intronic
938014708 2:127857902-127857924 GGCAAGCCCCAGCGCGGCGTGGG - Intronic
938480455 2:131658054-131658076 TCCAACGCGCGGCGGGGCGGGGG + Intergenic
941029174 2:160492960-160492982 GCCGAGCCCTGGCTGGCCGGCGG - Intronic
942276813 2:174328941-174328963 ACCAAGGCCCCGAGGGGCGGCGG - Intergenic
946202067 2:218076309-218076331 GCCATGCCCTGGCAGGGCTGGGG - Intronic
946818544 2:223606680-223606702 GCCAAGGCCCTGAGGGGCCGGGG - Intergenic
946865635 2:224039197-224039219 GCCAAGCGGCGGCGGCGAGGAGG + Intronic
947743894 2:232497753-232497775 GCCAGGCCCGGGCAGGGCTGGGG - Intergenic
947800948 2:232928237-232928259 GCCGGGCGGCGGCGGGGCGGGGG + Intronic
948467419 2:238159019-238159041 GGCGGGCTCCGGCGGGGCGGCGG - Exonic
1169557640 20:6767766-6767788 GCCAGTCCCCGGCGGGGTGTGGG - Exonic
1170889796 20:20367853-20367875 GCCTGGACCGGGCGGGGCGGCGG + Intergenic
1172026413 20:31951842-31951864 GCCAGGCCCCAGCGCCGCGGAGG + Intronic
1172098146 20:32470661-32470683 GCCAAGCCCCGGCTGAGGCGTGG - Intronic
1174377065 20:50133278-50133300 GCCAAGCACGGGAGGGGTGGTGG + Intronic
1175800411 20:61798174-61798196 GGCAGGGCCGGGCGGGGCGGGGG - Intronic
1175856289 20:62122585-62122607 GCCAGGCCACCGCGCGGCGGCGG + Exonic
1176151402 20:63592961-63592983 CACAAGCCCTGGCGGGGTGGTGG - Intronic
1176548454 21:8211859-8211881 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1176556348 21:8256067-8256089 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1176567385 21:8394894-8394916 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1176575287 21:8439109-8439131 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1179675019 21:42975066-42975088 GCCCGGCGCGGGCGGGGCGGCGG + Intronic
1180843452 22:18969838-18969860 GCCAGCCCCCAGCGGGGCCGGGG - Intergenic
1180843668 22:18970513-18970535 GCCCAGCCCCGGCCCGGCAGCGG - Intergenic
1181514297 22:23402470-23402492 GCCAGGCCCGGCCGGAGCGGCGG - Intergenic
1182118519 22:27772210-27772232 GCCCAGCCCCTGCTGGGCTGAGG - Intronic
1182477085 22:30582198-30582220 GCCAGGCCCAGCGGGGGCGGGGG + Intronic
1183966752 22:41446875-41446897 GCCCCGCCCCTGCAGGGCGGAGG - Exonic
1183981748 22:41544531-41544553 GCCCCGCCTCGGCGGGGTGGGGG - Intronic
1184687831 22:46104471-46104493 GCCAAGGCCAGACTGGGCGGGGG - Intronic
1203253338 22_KI270733v1_random:128164-128186 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1203261392 22_KI270733v1_random:173242-173264 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
950479924 3:13237881-13237903 GCCAAGCCCAGGCAGGGGGCGGG + Intergenic
952382677 3:32817224-32817246 GCCCAGGCCAGGCGAGGCGGGGG + Intergenic
954004084 3:47578460-47578482 GCCTGGCCGCGGCCGGGCGGCGG - Intronic
954367585 3:50154801-50154823 ACAAAGCCAGGGCGGGGCGGGGG + Intergenic
956678105 3:71753948-71753970 GCCCAGGGCCGGCGGAGCGGCGG + Intronic
956745776 3:72310068-72310090 GCCAAGCCATGGCGGGTGGGAGG + Intergenic
958575995 3:95950382-95950404 CCAAAGCCCCGTCAGGGCGGGGG - Intergenic
961359333 3:126357264-126357286 GCCAGGCCCCGGCGGTCCTGCGG + Exonic
961446264 3:126983148-126983170 GCGGAGCCCGGGCGCGGCGGCGG + Intergenic
962873686 3:139519530-139519552 GCCAAGCCCAGGCTGGGCTGTGG - Intronic
963870786 3:150410757-150410779 GCCCAGCCCCGGCAGGACCGAGG - Exonic
964118969 3:153162643-153162665 GCGCAGCCCCGACGGGGCCGCGG + Exonic
966201068 3:177359874-177359896 GCCCAGCCCAGGCGGGGCTCGGG - Intergenic
969462455 4:7335958-7335980 GCCAAGCCCCGGCCAGGAGGGGG - Intronic
971264912 4:25088769-25088791 TCCAAACCCGCGCGGGGCGGGGG + Intergenic
985549454 5:525569-525591 GCCAAGCCCCTGGGGAGCTGAGG - Intergenic
986706961 5:10460427-10460449 GCCAAGTCCCTGCGGGGGTGGGG - Intronic
987050411 5:14143580-14143602 GCAGAGCCCCGGGGCGGCGGGGG - Intergenic
987322687 5:16785113-16785135 GGCAAGCCCAGCCGGGGCGGGGG + Intronic
997301994 5:132813382-132813404 GCCGGGGCCCGGCGGGGCGCTGG + Intergenic
998266927 5:140673471-140673493 GGCGAGCCCCGCCGGAGCGGGGG - Exonic
998436000 5:142109127-142109149 GCCAAGCCCCGGCGTCGAGTTGG - Intronic
998583181 5:143402532-143402554 AGCAAGCCCTTGCGGGGCGGGGG + Intronic
999868668 5:155728420-155728442 GCGAAGCACCGGCGGGGAGGAGG + Intergenic
1000014688 5:157266433-157266455 GCGGAGCTCCGGCGCGGCGGCGG + Intronic
1001587706 5:172844664-172844686 GCCAGGCCCCGGGTGGGAGGGGG - Intronic
1001928744 5:175658168-175658190 GCCGAGGCCCCGCGGGGAGGCGG - Intronic
1002082160 5:176743574-176743596 GGCCAGCCCCGGGGGTGCGGGGG - Intergenic
1002334007 5:178465701-178465723 GCAAAGTCCCCGCGGGGTGGCGG + Intronic
1002541177 5:179907559-179907581 GCCAGCGCGCGGCGGGGCGGGGG - Intronic
1003874898 6:10426392-10426414 GCCAAACCCGGGCGGGCAGGGGG + Intergenic
1004140634 6:13014146-13014168 GCCGGGGCCCGTCGGGGCGGCGG + Intronic
1005385247 6:25279304-25279326 GCCGGGCTCCGGCTGGGCGGGGG - Intronic
1006028005 6:31159532-31159554 AGCCAGCCCCGGCGGGGGGGTGG - Exonic
1006271612 6:32970354-32970376 GGCAAACCCCGGGAGGGCGGGGG - Intronic
1007378615 6:41472446-41472468 GCCAAGCCCTGTTGGGGTGGAGG - Intergenic
1007390291 6:41546671-41546693 GCCATGCCCCGGCGGGGTTGAGG + Exonic
1007589817 6:43014319-43014341 GCCGAGCCGGGGCGGGGCCGCGG - Exonic
1007727268 6:43924024-43924046 GCCTTGCCCAGGCGGGGAGGGGG + Intergenic
1007736369 6:43984817-43984839 GTCCAGCCCTGGCGGGGCGGGGG - Intergenic
1007791154 6:44309281-44309303 GCCAAGCCCCAGAGGAGCTGCGG + Intronic
1014205618 6:118651959-118651981 GCCAAGCCAGGGCGCGGCTGAGG + Intronic
1016010835 6:139135791-139135813 GGGCAGCCGCGGCGGGGCGGAGG - Intronic
1019112075 6:169724454-169724476 GCCAGGCGGCGGCGGGGCTGAGG - Intronic
1019344626 7:523105-523127 GCCAAGCCCCGGAGGGGCCCCGG - Intergenic
1020016524 7:4834914-4834936 GCCAAGGCCCGGGCGGGCAGGGG + Exonic
1023791679 7:43758332-43758354 GCCTGGCCCCGGCGTGGGGGGGG - Intergenic
1023810346 7:43906613-43906635 GCCGAGCCGCGGCCGCGCGGAGG - Exonic
1023984956 7:45088951-45088973 GCGCAGGCTCGGCGGGGCGGCGG - Intergenic
1024004810 7:45217445-45217467 GCCAGGCCCCGTCAGGGCAGTGG - Intergenic
1026883321 7:73921022-73921044 GGCACGCCCAGGCGGGGCTGAGG + Intergenic
1027232643 7:76281669-76281691 GACGAGCCCCGGGGGGGCGCGGG - Exonic
1028622239 7:92836787-92836809 CCCACCCCCCGGCGGGGCTGGGG + Intergenic
1029075077 7:97928489-97928511 GCCCGGGCCCGGCGTGGCGGAGG - Intergenic
1029420085 7:100467770-100467792 CCCAGGCCCCGGTGGGGCGGGGG + Intronic
1029701387 7:102248795-102248817 GCCCTCCCCCGGCGCGGCGGCGG - Exonic
1034188385 7:149196003-149196025 GCGGAGGCCCCGCGGGGCGGGGG + Intronic
1034344789 7:150379496-150379518 CCCCAGCCCGGGCCGGGCGGAGG - Intronic
1034414096 7:150955874-150955896 GCTGGGCACCGGCGGGGCGGGGG - Intronic
1036258344 8:7222122-7222144 GCCTGGGCCCGGCGTGGCGGAGG - Intergenic
1036259405 8:7228266-7228288 GCCTGGGCCCGGCGTGGCGGAGG - Intergenic
1036310398 8:7680718-7680740 GCCTGGGCCCGGCGTGGCGGAGG - Intergenic
1036311447 8:7686836-7686858 GCCTGGGCCCGGCGTGGCGGAGG - Intergenic
1036723573 8:11200508-11200530 GCGAAGCACCGGGAGGGCGGAGG + Intronic
1037811578 8:22089701-22089723 TTCAAGCCCAGGCGAGGCGGTGG - Intronic
1037819823 8:22130259-22130281 GCCAGACCACGGCGGAGCGGTGG - Intronic
1040038734 8:42896370-42896392 GCCGAGGCTCTGCGGGGCGGCGG - Exonic
1048320527 8:133396207-133396229 GCCAAGCCCATGGGGGGGGGGGG - Intergenic
1049218422 8:141418064-141418086 CCCCAGCCCCGCCGGGGAGGAGG + Intronic
1049457326 8:142700373-142700395 GACAGGCCCCGGCGGGTGGGAGG + Exonic
1049549115 8:143248462-143248484 TCCACTCCACGGCGGGGCGGGGG - Intronic
1050537714 9:6645189-6645211 GCAGAGCCCGGGCAGGGCGGAGG + Intronic
1055574674 9:77648771-77648793 GCCAAGCCCGAGCTGGGCCGGGG - Intergenic
1055945739 9:81689590-81689612 GCCCAGCCCCGTTCGGGCGGGGG + Intergenic
1056985683 9:91361977-91361999 GCCAAGCCGGAGCGAGGCGGCGG - Intergenic
1056992490 9:91424185-91424207 GCCAAGAGCGGACGGGGCGGTGG - Intergenic
1057773237 9:97984702-97984724 GCCAAGCCCCGGCGGGGCGGGGG - Intronic
1057921737 9:99104238-99104260 ACCCAGCTCCCGCGGGGCGGAGG - Intronic
1059123367 9:111661820-111661842 GCGAGGCCTCGGCGGGGCGCGGG + Intronic
1060208883 9:121698826-121698848 GTCAATCCCCGACGGGGTGGGGG + Intronic
1060222575 9:121772500-121772522 GCCAGGCCCCGGCAGGTTGGCGG + Intronic
1060479991 9:124012214-124012236 GCCGAGCTCGGGCGGGGCCGGGG + Exonic
1061131905 9:128713165-128713187 GCCAAGCACCAGCGTGGCCGAGG + Exonic
1061285518 9:129620354-129620376 GCCAAGCCCGGGGTGGGCGTCGG - Exonic
1061289250 9:129641585-129641607 GCCACCCCCCGGCGTGGCAGAGG - Intronic
1061588259 9:131582560-131582582 GGCAAACCCAGGCGGGGCTGGGG + Intronic
1061610059 9:131740082-131740104 GCCGAGGCCCGGCGGGCGGGCGG - Intergenic
1061660644 9:132127972-132127994 GCCGAGGCCGGGTGGGGCGGGGG + Intergenic
1061961920 9:133992838-133992860 GCCACGGCCGGGCGGGGCAGGGG + Intergenic
1062018508 9:134304481-134304503 GCCAAGCCCAGGGTGGCCGGCGG - Intergenic
1062119743 9:134827852-134827874 GCCAAGCCCAGGCGGCGTGAAGG - Intronic
1062537645 9:137027917-137027939 GGCAGGGCCCGGCGGGGAGGGGG + Intronic
1062542739 9:137048777-137048799 GCGCAGCCCCGGCGGGTCGGCGG + Exonic
1062574637 9:137200494-137200516 GCCGAGCGGCGGCGCGGCGGGGG - Exonic
1062653565 9:137590542-137590564 GCCGAGCGGCGGCGGGCCGGGGG - Intergenic
1203469738 Un_GL000220v1:111311-111333 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1203477559 Un_GL000220v1:155283-155305 GACGGGCCCCGGCGGGGAGGAGG - Intergenic
1189331028 X:40145327-40145349 GCCACTCCCTAGCGGGGCGGAGG - Intronic
1190541210 X:51480698-51480720 CCAAAGCCCCGTCGGAGCGGGGG + Intergenic
1193462953 X:81811585-81811607 TCCCAGCCCCGGAGGGTCGGGGG + Intergenic
1195675886 X:107506980-107507002 GCCCAGCCCCGGCCCGGAGGGGG + Intergenic
1196719417 X:118839651-118839673 GCCATGCCCGGGCCGGACGGTGG + Intergenic