ID: 1057773237

View in Genome Browser
Species Human (GRCh38)
Location 9:97984702-97984724
Sequence GCCAAGCCCCGGCGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057773237_1057773250 5 Left 1057773237 9:97984702-97984724 CCCCCGCCCCGCCGGGGCTTGGC No data
Right 1057773250 9:97984730-97984752 CTGGCGGGAGCCGCGCGCCGCGG No data
1057773237_1057773247 -10 Left 1057773237 9:97984702-97984724 CCCCCGCCCCGCCGGGGCTTGGC No data
Right 1057773247 9:97984715-97984737 GGGGCTTGGCTCCCACTGGCGGG No data
1057773237_1057773254 30 Left 1057773237 9:97984702-97984724 CCCCCGCCCCGCCGGGGCTTGGC No data
Right 1057773254 9:97984755-97984777 GCCGCCGACTCATCCCGTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057773237 Original CRISPR GCCAAGCCCCGGCGGGGCGG GGG (reversed) Intronic