ID: 1057773434

View in Genome Browser
Species Human (GRCh38)
Location 9:97985373-97985395
Sequence GCGAGGGTGGGCCGCTCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057773416_1057773434 17 Left 1057773416 9:97985333-97985355 CCGGGCTCCACCGCACGGCGCTG No data
Right 1057773434 9:97985373-97985395 GCGAGGGTGGGCCGCTCCGGGGG No data
1057773418_1057773434 7 Left 1057773418 9:97985343-97985365 CCGCACGGCGCTGTCCTTCCCGG No data
Right 1057773434 9:97985373-97985395 GCGAGGGTGGGCCGCTCCGGGGG No data
1057773417_1057773434 10 Left 1057773417 9:97985340-97985362 CCACCGCACGGCGCTGTCCTTCC No data
Right 1057773434 9:97985373-97985395 GCGAGGGTGGGCCGCTCCGGGGG No data
1057773423_1057773434 -7 Left 1057773423 9:97985357-97985379 CCTTCCCGGAGGGCCCGCGAGGG No data
Right 1057773434 9:97985373-97985395 GCGAGGGTGGGCCGCTCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057773434 Original CRISPR GCGAGGGTGGGCCGCTCCGG GGG Intronic