ID: 1057775161

View in Genome Browser
Species Human (GRCh38)
Location 9:98001945-98001967
Sequence GTCCAGAGTCACACACCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057775153_1057775161 27 Left 1057775153 9:98001895-98001917 CCCTTGTTTTATATTGAGGAAGC 0: 1
1: 0
2: 1
3: 17
4: 282
Right 1057775161 9:98001945-98001967 GTCCAGAGTCACACACCCTGTGG No data
1057775154_1057775161 26 Left 1057775154 9:98001896-98001918 CCTTGTTTTATATTGAGGAAGCT 0: 1
1: 0
2: 1
3: 29
4: 295
Right 1057775161 9:98001945-98001967 GTCCAGAGTCACACACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057775161 Original CRISPR GTCCAGAGTCACACACCCTG TGG Intronic
No off target data available for this crispr