ID: 1057775835

View in Genome Browser
Species Human (GRCh38)
Location 9:98008617-98008639
Sequence AAACTTTGCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 3, 2: 26, 3: 62, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057775835_1057775836 10 Left 1057775835 9:98008617-98008639 CCTATCTTTGTGAAGCAAAGTTT 0: 1
1: 3
2: 26
3: 62
4: 253
Right 1057775836 9:98008650-98008672 CAGCAACCAAAACAAGATTATGG 0: 6
1: 8
2: 20
3: 28
4: 226
1057775835_1057775838 20 Left 1057775835 9:98008617-98008639 CCTATCTTTGTGAAGCAAAGTTT 0: 1
1: 3
2: 26
3: 62
4: 253
Right 1057775838 9:98008660-98008682 AACAAGATTATGGAGTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057775835 Original CRISPR AAACTTTGCTTCACAAAGAT AGG (reversed) Intronic
901398506 1:8999999-9000021 AATCTTTGCCTCACATAAATCGG - Intergenic
902061321 1:13645775-13645797 AAATCTTGCCTCACACAGATAGG + Intergenic
903476871 1:23625636-23625658 AAGTTTTGCTTCACACAGAGGGG - Intronic
904514429 1:31043046-31043068 AAACTTAGTTTCATAAAGAGAGG - Intronic
906309447 1:44742766-44742788 AAACTTTGCTTGCCCAAGCTAGG + Intronic
907245282 1:53104450-53104472 AGAGTTAGCTTCACAAAGAAGGG + Intronic
907827394 1:58032055-58032077 AAACTCTGCTTCTCAAAGTGTGG + Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909464160 1:75954037-75954059 AAACTTTGCTTCACTAATGCTGG - Intergenic
909662269 1:78097317-78097339 AAACTCTGCCTCACTAAGACTGG - Intronic
909685655 1:78345494-78345516 AAACATTATTTCTCAAAGATGGG - Intronic
910308217 1:85791718-85791740 AAAATTTTTTTCACACAGATAGG - Intronic
910824074 1:91387271-91387293 GAATTCTGCTTCACAATGATAGG + Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
915651423 1:157314001-157314023 AAACTATGCTTCACAAATCAAGG + Intergenic
916010837 1:160704120-160704142 AACCATTGTTTCACAAAGTTTGG + Intronic
916306793 1:163344662-163344684 AAACATTGCTTCACAAAAGATGG - Intronic
916548251 1:165827269-165827291 AAATTTTGCTTCTCAAACCTGGG + Intronic
917989026 1:180353300-180353322 AAGCTTTTCTTCACTGAGATTGG + Intronic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918455301 1:184705493-184705515 AAACTTTTATTTACAAAAATGGG + Intronic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
918777727 1:188656542-188656564 TAATTTTGCTTCTCAAAGAAGGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
921869767 1:220127141-220127163 AAACTTTGTTTTACAAAACTGGG - Intronic
922436203 1:225609403-225609425 AAACTTTGATTAACCAAAATTGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1064423648 10:15211465-15211487 AAAATTTTTTTCACAGAGATGGG + Intergenic
1067190657 10:44065202-44065224 AAACTGTGCTTCTCAAAGTGGGG - Intergenic
1067537893 10:47128575-47128597 AAACTATCCTTCAGAAAGAAAGG + Intergenic
1068046406 10:51891794-51891816 AAAATTTGATTTACAAAAATAGG + Intronic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1069679300 10:70272634-70272656 AAACTTTTCGTCAAACAGATCGG + Intronic
1070108527 10:73460228-73460250 AAACTTGGCTTCTGAAAGAAAGG + Intronic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1071278708 10:84079814-84079836 AAACTTTGCTTCCCAAGGGTCGG - Intergenic
1074628204 10:115218278-115218300 AAACTCTGCTCCACGAAGACAGG + Intronic
1075345359 10:121678308-121678330 AAAGTTGGCTTCACAATGACTGG - Intergenic
1075527891 10:123201646-123201668 AATCTTTGGTTCACAAGGTTAGG - Intergenic
1078320344 11:10328867-10328889 AAACATTACTTCACAAAAGTGGG + Intronic
1078505817 11:11943954-11943976 AATGTTTGCTTTACAAAGTTTGG - Intronic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079375639 11:19889254-19889276 AAAATTTGGTTCACAAACAAAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1079956915 11:26877660-26877682 AGAATTTGCTTCACAAATCTTGG - Intergenic
1079991094 11:27248066-27248088 AAACTTTGCATCACTAATACTGG + Intergenic
1080786954 11:35484243-35484265 AAACTGAGATTCACAAAGATTGG + Intronic
1081963822 11:47157510-47157532 AAACTTTTCTACACAAAGAGAGG + Intronic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1083305434 11:61759658-61759680 AAACTTTGTCTCAAAAAGAAAGG + Intronic
1083533752 11:63449479-63449501 AAGCTTTGCTTCAAAAAGAAGGG - Intergenic
1085027781 11:73247510-73247532 GGACTGTGCTGCACAAAGATGGG + Intergenic
1087179819 11:95130860-95130882 AAACTTTGCTTCCCACAATTGGG + Exonic
1090330791 11:125930661-125930683 AAACTTTGCTACTCAAAGTGTGG - Intergenic
1091197242 11:133742157-133742179 AAATTTTTTTTCGCAAAGATGGG - Intergenic
1091242039 11:134059611-134059633 AAAATTTTCTTCCTAAAGATGGG - Intergenic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1095570732 12:43682406-43682428 AAGCTTTCCTTCACAAAGTAAGG + Intergenic
1095670353 12:44852450-44852472 AAGCTTTGTTACACACAGATGGG + Intronic
1097946339 12:65372904-65372926 AAACTTTGCTTAAATAAGCTAGG + Intronic
1098265970 12:68719488-68719510 AAGCTATAGTTCACAAAGATTGG - Intronic
1098656091 12:73031508-73031530 AAGCTTTGGTTCACAAACCTAGG + Intergenic
1099149686 12:79094956-79094978 AAGCTTTGCTTGCCAAAAATGGG + Intronic
1099838205 12:87934620-87934642 AAAATTTGATTTACAAATATAGG + Intergenic
1100759840 12:97795146-97795168 ATAAGTTGCTTCACAAAGACTGG - Intergenic
1101415225 12:104503017-104503039 AGACTTTGCTACACAAAGTGTGG - Intronic
1102229078 12:111249961-111249983 GAACTTTGCAACACAAAGAGTGG - Intronic
1103186415 12:118961585-118961607 AAACTTTGCTCCTCAAAGTGTGG + Intergenic
1103219685 12:119233284-119233306 AAACTTTTCTTTACAAAATTGGG + Intergenic
1104394168 12:128417464-128417486 GAAATTTTCATCACAAAGATAGG + Intronic
1105710411 13:23002699-23002721 AAACATTACTACACAAAAATAGG + Intergenic
1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG + Intergenic
1107311117 13:39079344-39079366 AACATTGGGTTCACAAAGATGGG + Intergenic
1110639583 13:77806720-77806742 AAACTTTGCTTCACAAACTTGGG - Intergenic
1110811261 13:79812818-79812840 AAACTTTTCTTTACAAAAGTAGG - Intergenic
1111116267 13:83781576-83781598 AAACTATGCTTCATAAATAAAGG + Intergenic
1112897375 13:104316437-104316459 AACCTTAGCTTTACAGAGATAGG + Intergenic
1113011937 13:105777839-105777861 AAACTTGTCTTCTCAAAGGTAGG + Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1113611636 13:111650234-111650256 AAACTTTACTTCACACAAACAGG - Intronic
1114756658 14:25267723-25267745 AAACTAAGCTTCACAAATAAAGG - Intergenic
1114854207 14:26418075-26418097 AAACTTTGCTACTCAAAGTGTGG + Intergenic
1114941652 14:27619106-27619128 AAATTTTTCTTCACAAACAATGG + Intergenic
1115108284 14:29788158-29788180 AAACTCTCCTTCAAAAATATAGG - Intronic
1115411774 14:33083509-33083531 AAATGTTGCTTCAGAAGGATGGG + Intronic
1115582806 14:34778152-34778174 AAACTTTTGTTCAAAGAGATGGG + Intronic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1117702144 14:58424895-58424917 AAACCTAGCATCACAAACATGGG + Intronic
1118056963 14:62089008-62089030 AAACCTTGGATCAGAAAGATGGG + Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118597450 14:67446855-67446877 AAACTTTCTTTTACAAAGACAGG - Intergenic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1120589662 14:86360940-86360962 AAAGTTTGCTTAAGAAAGAATGG - Intergenic
1121094668 14:91208122-91208144 AAAATTTGCTTCAAAAATAAAGG + Intronic
1121665883 14:95671894-95671916 AAAATGTGCTTCACAAAGCTAGG + Intergenic
1122614630 14:103008718-103008740 AACCTTTTCTTCACAGAGAAAGG + Intronic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1125015802 15:34933509-34933531 ATATTTTTCTTCACAAACATTGG + Intronic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1127054337 15:55116175-55116197 AAACTTTGCTTAACAAACTGAGG + Intergenic
1127880346 15:63151816-63151838 AAACCCAGCTTCACAAGGATAGG - Exonic
1127930140 15:63590326-63590348 AAACTAAGCTTAACAAAGAAGGG - Intronic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1135163681 16:20119885-20119907 GAGATTTGCTTCACAATGATTGG - Intergenic
1135929024 16:26721015-26721037 AGGCTTTGCTACACAAAGAAAGG + Intergenic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1140601045 16:76475264-76475286 AAACTCTGCTCCCCAAAGATAGG + Intronic
1140991389 16:80215690-80215712 GAACATTGCTTCAAAGAGATAGG - Intergenic
1146021147 17:29280303-29280325 AAAGTTTACTTCAAAAAGTTAGG + Intronic
1147322995 17:39657228-39657250 AACCTTTGCTCCACAAGGCTGGG + Intronic
1148984690 17:51611477-51611499 ATAATTTGTTTCACAAATATGGG - Intergenic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1150337320 17:64340176-64340198 AAACAGTGCTTCTCAAATATTGG + Intronic
1150993282 17:70286110-70286132 AACCTGTGCTTGACAATGATGGG + Intergenic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1155929818 18:31695122-31695144 AAATTTTTTTTCTCAAAGATAGG - Intergenic
1156333003 18:36143037-36143059 AAACTATCCTTCACATAGGTGGG - Intronic
1159735477 18:72092076-72092098 AAATTTTGATGCACAAAAATGGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160033731 18:75283007-75283029 AAACTCCCTTTCACAAAGATGGG + Intronic
1160055525 18:75475973-75475995 ACATTTTCCTTCACACAGATTGG - Intergenic
1160481987 18:79249423-79249445 AAAATTTGCTTTACTAATATAGG + Intronic
1161304977 19:3562283-3562305 AAACTGAGTTTCACAAAGACGGG + Intronic
1161912995 19:7208469-7208491 AAACTTTGCTTTAGAAAAATGGG + Intronic
926478494 2:13357928-13357950 TATCTCTGTTTCACAAAGATTGG - Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
927294924 2:21443259-21443281 GAACTTTGCTACTCAAAGAATGG + Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
929707900 2:44235002-44235024 AAACCTGGCCTCACACAGATAGG + Intronic
930403121 2:50916789-50916811 AAACTTTGCTTCACAGAGCCAGG + Intronic
931082440 2:58789794-58789816 ATATTTTGCTTCAAAAAGAGGGG - Intergenic
931880228 2:66561006-66561028 AAATTTTATTTCACAAAGAAAGG + Intronic
932309144 2:70725907-70725929 AAACTTTGCTACTCAAAGTATGG - Intronic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
936911167 2:117595481-117595503 AAACTAAGCTTCACAAATAAAGG - Intergenic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937937141 2:127255411-127255433 AGACTTTGCTTTACAAACTTTGG - Intergenic
938676955 2:133646493-133646515 AAACTTTCCTTCAAAAATAAAGG + Intergenic
938812121 2:134863200-134863222 TTTCTTTGCTTTACAAAGATTGG + Intronic
938820148 2:134949436-134949458 AAACTTTTGTTGACAAAAATAGG + Intronic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
943430012 2:187787928-187787950 AAAATTTGATTCAAAAAAATGGG + Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944176943 2:196840836-196840858 AAACTTTTTTTCACAAAAGTAGG - Exonic
945568242 2:211431150-211431172 AAACTTTGTTTTAGAAAAATGGG - Intronic
945931520 2:215860143-215860165 AAAATTTGGTTTACAAAAATAGG - Intergenic
947980412 2:234403835-234403857 CCACATTGCTTCACAAAGAGAGG - Intergenic
948576896 2:238958043-238958065 AAACTAAGCTTCATAAAGAAAGG + Intergenic
1169969295 20:11251572-11251594 AATTTTTGCTTCGAAAAGATAGG + Intergenic
1173658696 20:44718447-44718469 AAACTTGGCCCCCCAAAGATGGG + Intronic
1174092141 20:48058092-48058114 TAACATGGCTTCATAAAGATTGG + Intergenic
1174926684 20:54767993-54768015 AAACTTGCACTCACAAAGATCGG + Intergenic
1175694980 20:61095740-61095762 GAAAACTGCTTCACAAAGATAGG + Intergenic
1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG + Intronic
1176550366 21:8218333-8218355 GAATTCTGCTTCACAATGATAGG - Intergenic
1176569294 21:8401371-8401393 GAATTCTGCTTCACAATGATAGG - Intergenic
1176577208 21:8445603-8445625 GAATTCTGCTTCACAATGATAGG - Intergenic
1177067062 21:16452386-16452408 AAACTTAGCTTAACAAAGAAAGG - Intergenic
1177273880 21:18881698-18881720 AAACCATGATTCACATAGATAGG + Intergenic
1177802625 21:25842802-25842824 AAACATTGATTCCCACAGATGGG - Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1181104015 22:20561602-20561624 AAACTTTTCTGCTGAAAGATAGG + Intronic
1182915538 22:34026031-34026053 TAACTTTTCTTCACCAACATTGG - Intergenic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
1203255261 22_KI270733v1_random:134671-134693 GAATTCTGCTTCACAATGATAGG - Intergenic
1203263317 22_KI270733v1_random:179750-179772 GAATTCTGCTTCACAATGATAGG - Intergenic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
951057916 3:18169248-18169270 CAATTTTGCTTAAGAAAGATAGG - Intronic
953180981 3:40595249-40595271 AATCTGTGCTTCTCAAAGAATGG + Intergenic
954094737 3:48316844-48316866 AAACTATTCTTCAGAAAGAAAGG + Intronic
954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG + Intronic
954542374 3:51402436-51402458 AAACTTTGTTTTGCAAAAATAGG - Intronic
956316365 3:67942239-67942261 AAACGTTGCTTCAAAGAGAGAGG + Intergenic
957152518 3:76504155-76504177 AAACTTTGTTTTACAATGTTTGG + Intronic
958535978 3:95403954-95403976 AACCCTTGCTTCACTAATATAGG + Intergenic
959290776 3:104470075-104470097 AATATTTGCTTCTCAAAGGTGGG - Intergenic
960795744 3:121485268-121485290 AAATTTTGCCTATCAAAGATAGG - Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961801258 3:129451669-129451691 AACCTTTGGTTCTCAAGGATTGG + Intronic
961865878 3:129953142-129953164 TAACTCTGCTTCTCAGAGATGGG - Intergenic
962556689 3:136559763-136559785 AAACTCAGCCTCTCAAAGATAGG - Intronic
962895181 3:139707548-139707570 AAACTCAGCTTCCCAATGATAGG - Intergenic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964495479 3:157285285-157285307 AATCTGTGCTTCACAAAGGCTGG + Intronic
964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG + Intergenic
964662032 3:159130912-159130934 ACACTTTTCTTCTGAAAGATAGG - Intronic
965454189 3:168876960-168876982 ATACTTTGCTTCCCACAAATTGG - Intergenic
966369134 3:179228548-179228570 AAATCTGGCCTCACAAAGATAGG - Intronic
967661162 3:192112396-192112418 AAACTGTGATTAACAAAGAATGG - Intergenic
968779370 4:2568220-2568242 AAATTTTTTTTCAAAAAGATTGG + Intronic
969187486 4:5487347-5487369 AGACTTGGCATCACAAAGATTGG + Intronic
969992316 4:11277320-11277342 AATCTTTGCTTTTCAAAGAGTGG - Intergenic
970717734 4:18946989-18947011 TAACTTTGCTTCATAAGAATGGG + Intergenic
970898353 4:21129405-21129427 AAACTTTGGTTCAGAAGGATTGG + Intronic
971066280 4:23036307-23036329 ACACTTTGCTTCTCTAAGTTAGG - Intergenic
971738709 4:30492511-30492533 AAATTTTGCTTCACATATTTCGG - Intergenic
971773996 4:30936736-30936758 AATATTTACTTCACAAAAATTGG + Intronic
974269866 4:59636103-59636125 AAACTTTGCTTTATAAATCTGGG - Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975520810 4:75299225-75299247 AAACTATGCTTCACAAATGAAGG - Intergenic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
975798819 4:78036845-78036867 AAACTTTTCTTCACATAAATGGG + Intergenic
975803948 4:78092761-78092783 AAATTTTGCTTCACAGAAAAAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG + Intergenic
978874288 4:113620088-113620110 AAAATGTGTTTCTCAAAGATAGG + Intronic
979504216 4:121477177-121477199 AATCTTTGCTTCACTCACATTGG + Intergenic
979734112 4:124061359-124061381 AGATTTTGCTTCAAAAAAATTGG - Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
981736662 4:147960400-147960422 AAACTTGTCTTTACAAACATTGG + Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
984949231 4:184994423-184994445 GAACTTTGCGTCCCACAGATCGG - Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987267385 5:16270984-16271006 AAACAGTGCTGCACAAACATGGG - Intergenic
987270691 5:16305244-16305266 GAACTTTCCTTGATAAAGATAGG - Intergenic
987734715 5:21825655-21825677 AAACTTTACTACACAATGATGGG - Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
989662807 5:43817402-43817424 AAGCTTTGCTTCACTAATATAGG - Intergenic
990373490 5:55145491-55145513 AAATTTTGCTTCTGAAGGATGGG + Intronic
993971750 5:94428492-94428514 AAACTAAGCTTCACAAACAAAGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995740932 5:115355018-115355040 AAACTTTGAGTCAGAAATATTGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
995938560 5:117549356-117549378 AAACTTTGTTTCAAAAAGAATGG + Intergenic
996039161 5:118791277-118791299 AAAACTTTCTTCACAAAAATAGG - Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
999501731 5:152153494-152153516 AAAATTTGCTTCAAACAGATTGG + Intergenic
1000160290 5:158590763-158590785 AATCTATGCTTCAGACAGATGGG - Intergenic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1002313477 5:178328609-178328631 AAACTATGCTTCAGAAAGGAAGG + Intronic
1003124186 6:3342495-3342517 AAACAGTGCTTCTCAAAGGTGGG + Intronic
1003562854 6:7197654-7197676 AGACTTTGCCTCAAAAAGAAGGG + Intronic
1003917516 6:10800964-10800986 AAACGTGGCATCACAAAGAGGGG - Intronic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004403741 6:15312374-15312396 AAATTTTACTTCAATAAGATTGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004770081 6:18771507-18771529 ATACCCTGCTTCACAAAGTTAGG - Intergenic
1006969667 6:38028852-38028874 ATGCCTTGCTTCACAAAGAAAGG - Intronic
1009947575 6:70357440-70357462 AAAATGTGCTTCTCCAAGATTGG + Intergenic
1010899305 6:81406373-81406395 AACCTTTGCTTCTTAAAAATAGG - Intergenic
1011085887 6:83540428-83540450 ACATTTTGCTTCAAAAATATAGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1014949903 6:127542238-127542260 AAACTTAGCCTCAGAAAGAAGGG - Intronic
1016048032 6:139500649-139500671 AAGCTTTGCATCACCAATATTGG - Intergenic
1016183265 6:141172471-141172493 AAACCTTTATTCACAAAAATGGG - Intergenic
1016871266 6:148819110-148819132 GAACTTTGCATCACAAAGGTAGG + Intronic
1016909960 6:149189035-149189057 AAACTAAGCTTCACAAACAAAGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017119354 6:151009225-151009247 AAGCTTTTCTTCATACAGATGGG - Intronic
1017237757 6:152134928-152134950 CATGTTTGCTTTACAAAGATTGG + Intronic
1018106463 6:160492041-160492063 ATAGTTTGCTTCATAAGGATGGG + Intergenic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG + Intronic
1024062970 7:45712850-45712872 AATTTCTGCTTCACAAAGTTAGG - Intronic
1027549987 7:79579061-79579083 ATACTTTGTTTCACAATGATTGG + Intergenic
1027713829 7:81643729-81643751 AAACTTTGCCACACACATATTGG - Intergenic
1028030793 7:85909384-85909406 AAACTAAGCTTCACAAACAAAGG + Intergenic
1028223795 7:88226386-88226408 AAACTTTGCGACATCAAGATTGG - Intronic
1028250774 7:88538047-88538069 AAACTAAGCTTCACAAATAAAGG - Intergenic
1029412391 7:100422949-100422971 AAACTTTTCTTCAGAAAGCTGGG - Intronic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1038235354 8:25747556-25747578 ACACTTGGCTTCACAAAGAAAGG - Intergenic
1038300326 8:26340090-26340112 AAGCTTTGCTTGACAAAGAATGG + Intronic
1038596196 8:28889037-28889059 TAACTTGGCTGCACAAATATGGG + Intronic
1041567661 8:59298375-59298397 AAGCTATGATTCACAAACATGGG + Intergenic
1041596460 8:59659679-59659701 CAACTATGCTTGACAAAGAAAGG + Intergenic
1041737174 8:61123616-61123638 AAACTTTGCTCCAAAAATTTGGG + Intronic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1044466273 8:92510125-92510147 AAACTTTTGTTCTCATAGATTGG - Intergenic
1045228656 8:100277786-100277808 AAACTTTGATTAAAAAAAATAGG - Intronic
1045235121 8:100345568-100345590 AAAATTTGCTTCAAAAGGAAAGG - Intronic
1045823730 8:106372169-106372191 AAACTGTGCTACCCACAGATTGG - Intronic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1046477746 8:114769421-114769443 AAACTGTCCTTCACAAACAAAGG + Intergenic
1047690154 8:127343845-127343867 AAAATTTGATTTACAAAAATAGG + Intergenic
1048133392 8:131721706-131721728 AAAGTTTTCTTCACAAATATAGG + Intergenic
1048316648 8:133368031-133368053 AAACTATCCTTCACACAGAGGGG + Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1051151456 9:14084264-14084286 AAAGTTAGCTTTACAAACATGGG + Intronic
1051378808 9:16434180-16434202 ATATTTTGCTTTTCAAAGATTGG + Intronic
1051506516 9:17832763-17832785 AGATTTTTCTTCACAAAGACTGG + Intergenic
1052838058 9:33265871-33265893 AAACAGTGGTTCACAAAGAAGGG - Intronic
1055097986 9:72434140-72434162 AGACTTTGCTTCACTAACCTTGG + Intergenic
1055222491 9:73953630-73953652 AAACTAAGCTTCACAAACAAAGG + Intergenic
1056689102 9:88791082-88791104 AAATTCTGCTTCAAAAAAATTGG - Intergenic
1056802374 9:89701553-89701575 TAACGTTGCTACACAAAGGTTGG + Intergenic
1056972499 9:91218586-91218608 AAACTTTACTTCCCAAAGTGTGG - Intronic
1057620928 9:96634194-96634216 AAACTTGACTTGAAAAAGATTGG + Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058041080 9:100302685-100302707 AATCTCTTCTTTACAAAGATGGG + Intronic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1203471659 Un_GL000220v1:117808-117830 GAATTCTGCTTCACAATGATAGG - Intergenic
1203479480 Un_GL000220v1:161780-161802 GAATTCTGCTTCACAATGATAGG - Intergenic
1186910827 X:14163363-14163385 AAACTTTACTTCAAAAATAAAGG - Intergenic
1186936075 X:14451053-14451075 AAACTTAGCTTCATAAATACAGG + Intergenic
1187461859 X:19494147-19494169 AAAGTTTGCTAAACCAAGATAGG - Intronic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188455018 X:30354351-30354373 AAACCTTGCTTTACAAATCTGGG + Intergenic
1188600020 X:31951942-31951964 AAACTATCCTTCAAAAATATAGG - Intronic
1188782809 X:34306262-34306284 AACCTTTTCTTTTCAAAGATTGG - Intergenic
1188957951 X:36455934-36455956 AAACTTAGTTTCATAAAGAAAGG + Intergenic
1190589007 X:51978331-51978353 ATATTTTGCTTCACATAGACTGG + Intergenic
1192023976 X:67427963-67427985 AAAATTTGCTTCACATATTTGGG + Intergenic
1192344682 X:70291259-70291281 AAATTTTTCTTCTAAAAGATAGG - Intronic
1192505711 X:71680865-71680887 AAACTTAGCTGCAGAAGGATAGG - Intergenic
1192715488 X:73637114-73637136 AAACTTTCCTTCAAAAATAAAGG - Intronic
1193894572 X:87097343-87097365 AAACTATGCTTCACAAGCAAAGG - Intergenic
1194027555 X:88771540-88771562 AAACTTTTCTTCATAAATAATGG + Intergenic
1194193022 X:90860230-90860252 ACACTCTGTTTCACAGAGATAGG + Intergenic
1195133903 X:101884174-101884196 AAAACTTGTTTCAGAAAGATAGG - Exonic
1195694942 X:107660006-107660028 AAACTTTGATTAACATAAATAGG + Intergenic
1195960712 X:110383324-110383346 AAATTTTGCTAAGCAAAGATAGG - Intronic
1197994207 X:132354566-132354588 AAAATTTGCTTCACTGAAATCGG + Intergenic
1198415480 X:136415530-136415552 TAACTTTCCCACACAAAGATGGG - Intronic
1198867148 X:141135638-141135660 CAACTTTTCTTCACAATTATTGG - Intergenic
1199206104 X:145149990-145150012 AAACTAAGCTTCACAAATAAAGG + Intergenic
1199494750 X:148440765-148440787 AAACTATGCTTCACACAGCTAGG - Intergenic
1200539642 Y:4442680-4442702 ACACTCTGTTTCACAGAGATAGG + Intergenic
1201354583 Y:13083708-13083730 TCACTTTGCTTCACAAAAACTGG - Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic