ID: 1057775835

View in Genome Browser
Species Human (GRCh38)
Location 9:98008617-98008639
Sequence AAACTTTGCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057775835_1057775836 10 Left 1057775835 9:98008617-98008639 CCTATCTTTGTGAAGCAAAGTTT No data
Right 1057775836 9:98008650-98008672 CAGCAACCAAAACAAGATTATGG No data
1057775835_1057775838 20 Left 1057775835 9:98008617-98008639 CCTATCTTTGTGAAGCAAAGTTT No data
Right 1057775838 9:98008660-98008682 AACAAGATTATGGAGTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057775835 Original CRISPR AAACTTTGCTTCACAAAGAT AGG (reversed) Intronic