ID: 1057779182

View in Genome Browser
Species Human (GRCh38)
Location 9:98035877-98035899
Sequence CTCATTCAGAAAATATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057779181_1057779182 15 Left 1057779181 9:98035839-98035861 CCTCAGTCATCGCTGTCATATTT No data
Right 1057779182 9:98035877-98035899 CTCATTCAGAAAATATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057779182 Original CRISPR CTCATTCAGAAAATATTTAT TGG Intergenic
No off target data available for this crispr