ID: 1057780672

View in Genome Browser
Species Human (GRCh38)
Location 9:98047458-98047480
Sequence TGGGACTCCTTGGGTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057780664_1057780672 23 Left 1057780664 9:98047412-98047434 CCACTGCTGTAAAGATACCCAAA No data
Right 1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG No data
1057780665_1057780672 6 Left 1057780665 9:98047429-98047451 CCCAAAAAGATATTCAAGCTCTA No data
Right 1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG No data
1057780666_1057780672 5 Left 1057780666 9:98047430-98047452 CCAAAAAGATATTCAAGCTCTAA No data
Right 1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057780672 Original CRISPR TGGGACTCCTTGGGTAAAAC AGG Intergenic
No off target data available for this crispr