ID: 1057781151

View in Genome Browser
Species Human (GRCh38)
Location 9:98051602-98051624
Sequence ATGCCCTTCTAGAGGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057781144_1057781151 18 Left 1057781144 9:98051561-98051583 CCCCTTTTACTCCAAACCATAGA No data
Right 1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG No data
1057781146_1057781151 16 Left 1057781146 9:98051563-98051585 CCTTTTACTCCAAACCATAGAAA No data
Right 1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG No data
1057781149_1057781151 2 Left 1057781149 9:98051577-98051599 CCATAGAAAAAGGACTTAACAAA No data
Right 1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG No data
1057781148_1057781151 7 Left 1057781148 9:98051572-98051594 CCAAACCATAGAAAAAGGACTTA No data
Right 1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG No data
1057781145_1057781151 17 Left 1057781145 9:98051562-98051584 CCCTTTTACTCCAAACCATAGAA No data
Right 1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057781151 Original CRISPR ATGCCCTTCTAGAGGAGTGA AGG Intergenic
No off target data available for this crispr