ID: 1057783798

View in Genome Browser
Species Human (GRCh38)
Location 9:98071929-98071951
Sequence CCGTGCCCTGCAGGTGGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057783787_1057783798 21 Left 1057783787 9:98071885-98071907 CCTCCTTGCCCGTGAGGCTGCCA 0: 1
1: 0
2: 2
3: 10
4: 171
Right 1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG No data
1057783788_1057783798 18 Left 1057783788 9:98071888-98071910 CCTTGCCCGTGAGGCTGCCAAGG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG No data
1057783792_1057783798 12 Left 1057783792 9:98071894-98071916 CCGTGAGGCTGCCAAGGCGGAGT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG No data
1057783791_1057783798 13 Left 1057783791 9:98071893-98071915 CCCGTGAGGCTGCCAAGGCGGAG 0: 1
1: 0
2: 1
3: 16
4: 204
Right 1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG No data
1057783793_1057783798 1 Left 1057783793 9:98071905-98071927 CCAAGGCGGAGTCACTTCTTTAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057783798 Original CRISPR CCGTGCCCTGCAGGTGGCAT CGG Intronic
No off target data available for this crispr