ID: 1057784684

View in Genome Browser
Species Human (GRCh38)
Location 9:98077968-98077990
Sequence TTTGCTCAAGAACACTGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057784679_1057784684 2 Left 1057784679 9:98077943-98077965 CCTCTGCCTCTTTAATTCAGTTC 0: 1
1: 0
2: 0
3: 24
4: 278
Right 1057784684 9:98077968-98077990 TTTGCTCAAGAACACTGTCGGGG No data
1057784680_1057784684 -4 Left 1057784680 9:98077949-98077971 CCTCTTTAATTCAGTTCCTTTTG 0: 1
1: 0
2: 2
3: 56
4: 396
Right 1057784684 9:98077968-98077990 TTTGCTCAAGAACACTGTCGGGG No data
1057784678_1057784684 22 Left 1057784678 9:98077923-98077945 CCTCTTGGCAGTGTGAAATTCCT 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1057784684 9:98077968-98077990 TTTGCTCAAGAACACTGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057784684 Original CRISPR TTTGCTCAAGAACACTGTCG GGG Intronic
No off target data available for this crispr