ID: 1057789604

View in Genome Browser
Species Human (GRCh38)
Location 9:98115677-98115699
Sequence AAGAATACTCACAAATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2091
Summary {0: 1, 1: 1, 2: 4, 3: 42, 4: 2043}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057789604 Original CRISPR AAGAATACTCACAAATAGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr