ID: 1057790121

View in Genome Browser
Species Human (GRCh38)
Location 9:98119143-98119165
Sequence GCTCCGACCTCCCAGGGGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 1, 2: 0, 3: 43, 4: 397}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057790115_1057790121 -7 Left 1057790115 9:98119127-98119149 CCGCATCCCTCGACAAGCTCCGA 0: 1
1: 0
2: 1
3: 8
4: 170
Right 1057790121 9:98119143-98119165 GCTCCGACCTCCCAGGGGTCCGG 0: 1
1: 1
2: 0
3: 43
4: 397
1057790114_1057790121 -3 Left 1057790114 9:98119123-98119145 CCAGCCGCATCCCTCGACAAGCT 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1057790121 9:98119143-98119165 GCTCCGACCTCCCAGGGGTCCGG 0: 1
1: 1
2: 0
3: 43
4: 397
1057790110_1057790121 25 Left 1057790110 9:98119095-98119117 CCACGCGGTCGCCATGCTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1057790121 9:98119143-98119165 GCTCCGACCTCCCAGGGGTCCGG 0: 1
1: 1
2: 0
3: 43
4: 397
1057790113_1057790121 7 Left 1057790113 9:98119113-98119135 CCGGGCAGCGCCAGCCGCATCCC 0: 1
1: 0
2: 3
3: 27
4: 269
Right 1057790121 9:98119143-98119165 GCTCCGACCTCCCAGGGGTCCGG 0: 1
1: 1
2: 0
3: 43
4: 397
1057790112_1057790121 14 Left 1057790112 9:98119106-98119128 CCATGCTCCGGGCAGCGCCAGCC 0: 1
1: 0
2: 2
3: 23
4: 294
Right 1057790121 9:98119143-98119165 GCTCCGACCTCCCAGGGGTCCGG 0: 1
1: 1
2: 0
3: 43
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057790121 Original CRISPR GCTCCGACCTCCCAGGGGTC CGG Exonic
900409973 1:2508042-2508064 CCTCAGAGCTCCCAGGGGCCAGG + Intergenic
900410505 1:2510485-2510507 GCTCCGAGCCCCCTGGGCTCAGG - Intronic
901099196 1:6706225-6706247 GCCTCGACCTCCCCGGGCTCTGG - Intergenic
901233340 1:7653342-7653364 GCCTCGACCTCCCTGGGCTCAGG + Intronic
901368640 1:8776799-8776821 GCCTCGACCTCCCCGGGATCAGG + Intronic
901847503 1:11992883-11992905 GCCTCGACCTCCCTGGGCTCAGG + Intronic
903046331 1:20566741-20566763 GCTTCGGCCTCCCAGAGTTCTGG - Intergenic
903397394 1:23012259-23012281 GCCTCGACCTCCCTGGGATCAGG - Intronic
904698420 1:32343776-32343798 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
905135543 1:35796390-35796412 GCTTCGACCTCCCAGAGTGCTGG + Intergenic
905815116 1:40944040-40944062 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
906272152 1:44488050-44488072 GCCTCGACCTCCCAAGGCTCAGG + Intronic
906522695 1:46476809-46476831 GCCCAGACCTGGCAGGGGTCAGG - Intergenic
906822506 1:48944223-48944245 GCTCAGTCTTCCCAGGGGTTAGG + Intronic
907891914 1:58644781-58644803 GCTCTGACCACCCAGGGATCAGG - Intergenic
909648801 1:77950241-77950263 GCCTCAACCTCCCAGGGCTCAGG + Intronic
910971619 1:92861859-92861881 GCCTCGACCTCCCTGGGCTCGGG + Intronic
911623824 1:100097745-100097767 GCCTCGACCTCCCTGGGCTCAGG - Intronic
912382232 1:109253862-109253884 GCTGCCGCCACCCAGGGGTCAGG + Intronic
912532015 1:110331498-110331520 GCCTCGACCTCCCAAGGCTCAGG - Intergenic
912878150 1:113383925-113383947 GCCTCGACCTCCCATGGCTCAGG + Intergenic
914003773 1:143715262-143715284 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
914743832 1:150486794-150486816 GCTCCGGCCTCCCAGAGTTCTGG - Intergenic
915108627 1:153549280-153549302 GCTCAAAACCCCCAGGGGTCGGG - Exonic
915458623 1:156056083-156056105 GCCTCGACCTCCCTGGGCTCAGG + Intronic
916537531 1:165717741-165717763 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
916794155 1:168150193-168150215 CCTCCCACCTCCCAGGTGTCTGG - Intergenic
917885919 1:179384843-179384865 GCTGCAACCTCCCTGGGCTCAGG + Intronic
917953195 1:180063271-180063293 GCCTTGACCTCCCAGGGGTTAGG + Intronic
918155522 1:181842227-181842249 GCTTCTACCTCCCTAGGGTCAGG + Intergenic
918609565 1:186473000-186473022 GCCTCGACCTCCCAGAGTTCAGG + Intergenic
919775990 1:201194317-201194339 TCTCCTACCTCCCAGGGGAGAGG + Intronic
920383462 1:205549595-205549617 GCTTCTACCTCCCTGGGCTCAGG - Intergenic
921040469 1:211426426-211426448 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
921091559 1:211848481-211848503 GCTCCGGCCTCCCAAGGTGCTGG - Intergenic
922113966 1:222590972-222590994 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
922514368 1:226196041-226196063 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
922960136 1:229639211-229639233 GCACCGACCTCCCTGGGCTCAGG - Intronic
923573078 1:235134102-235134124 GCCTCGACCTCCCAAGGTTCAGG + Intronic
923652845 1:235889881-235889903 GCTTCGACCTCCCCAGGCTCAGG - Intergenic
1063948247 10:11198377-11198399 GGTCAGACCTCCTAGGAGTCTGG + Intronic
1064192872 10:13222771-13222793 GCTTCAACCTCCCAGGGCTCAGG + Intronic
1064649717 10:17496574-17496596 GCTTCGACCTCCCAAGGCTCAGG - Intergenic
1065172029 10:23040868-23040890 GCCTCGACCTCCCAGGGCTCAGG + Intergenic
1065189883 10:23199192-23199214 GCTCCGCGTTCCCAGGGTTCCGG + Intergenic
1065537655 10:26730525-26730547 GCCTCGACCTCCCAGGGCTCAGG - Intronic
1066461402 10:35615590-35615612 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1067468368 10:46518209-46518231 TCTCCTTCCTCCCAGGTGTCTGG + Intergenic
1069538789 10:69277483-69277505 GCCTCGACCTCCCAAGGCTCAGG - Intronic
1069584198 10:69586558-69586580 GCTCAGACTTCCCAGGGATGAGG + Intergenic
1070124748 10:73612027-73612049 GCTTCAACCTCCCTGGGCTCAGG - Intronic
1071443359 10:85723913-85723935 TCTCCTACCTCTGAGGGGTCTGG - Intronic
1072345276 10:94498849-94498871 ACCCCGACCTCCCTGGGCTCAGG + Intronic
1072643921 10:97236729-97236751 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1073186043 10:101615588-101615610 GCCCTGACCTCTCAGGGGTGTGG - Intronic
1073413642 10:103363490-103363512 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1073514028 10:104061373-104061395 GCTCCCAGCTGCCAGGGTTCAGG - Intronic
1074992953 10:118727309-118727331 GCTTTGACCTCCCTGGGCTCAGG - Intronic
1076070945 10:127488568-127488590 GCTTCGACATCACATGGGTCCGG + Intergenic
1078100098 11:8325377-8325399 GCTTCGGCCTCCCAGAGTTCTGG + Intergenic
1078760675 11:14248898-14248920 GCTCCGACAGCCCAGGGTGCAGG + Intronic
1079029340 11:16974182-16974204 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1079058486 11:17227840-17227862 GCCCCGGCCTCCCAGAGTTCTGG + Intronic
1080541133 11:33266623-33266645 GCATCGACCTCCCTGGGCTCAGG - Intronic
1080676058 11:34428444-34428466 GCTCCAACCTTCCAGAGGTCTGG + Intergenic
1083235170 11:61346438-61346460 GCTGCCACCGCCCCGGGGTCTGG - Exonic
1083334391 11:61914268-61914290 ACTCCAACCTCCCAGGGGTTGGG - Intronic
1084713928 11:70861795-70861817 GCTCTGAGCTCCCTGAGGTCTGG - Intronic
1084832740 11:71782330-71782352 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1084890330 11:72233581-72233603 GCTCCCACCTCCCAAGGTTAGGG - Intronic
1085070088 11:73535925-73535947 GCCCCAACCTCCCTGGGCTCAGG + Intronic
1085199768 11:74694841-74694863 TCTGCCAGCTCCCAGGGGTCTGG - Intergenic
1085378240 11:76087955-76087977 GCCTAGACCTCCCTGGGGTCAGG + Intronic
1085390024 11:76177540-76177562 GCTCCGGCCTCCGAGGGGCTGGG - Intergenic
1088694659 11:112356363-112356385 GCCTCAACCTCCCAGGGTTCAGG + Intergenic
1089530528 11:119125593-119125615 GCTTCGACCTCCCCAGGCTCAGG - Intronic
1089692507 11:120195625-120195647 GCTGAGACCTCCCAAGGGGCAGG - Intergenic
1090125260 11:124077595-124077617 GCTTCAACCTCCCTGGGATCGGG + Intergenic
1090297352 11:125600441-125600463 GCTTCAACCTCCCTGGGCTCAGG + Intronic
1090827730 11:130399684-130399706 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1091398390 12:168408-168430 GCTCCGTCCTCCCAGGCGCCGGG + Intronic
1092280359 12:7093208-7093230 CCTCCTCCCTCCCAGGGGCCTGG - Intronic
1092952328 12:13518045-13518067 ACTGGGACCTGCCAGGGGTCGGG - Intergenic
1093897727 12:24593496-24593518 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1094190783 12:27696096-27696118 GCTTCAACCTCCCTGGGCTCAGG - Intergenic
1096434468 12:51576928-51576950 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1097090919 12:56504078-56504100 GCCTCGACCTCCAAGGGGTTAGG + Intergenic
1097101527 12:56593221-56593243 GCCTCGACCTCCCAAGGCTCAGG + Exonic
1099460311 12:82912854-82912876 GCTTCGACCTCCCCAGGATCAGG - Intronic
1100116098 12:91306263-91306285 CCCCCTACCTCCCTGGGGTCTGG - Intergenic
1100319091 12:93473341-93473363 GCTTCGACCTCCCTGGGCTCAGG + Intronic
1100997396 12:100317011-100317033 GCCTCGACCTCCCAGGGCTCAGG - Intronic
1101208570 12:102513500-102513522 GCCTCAACCTCCCAGGTGTCTGG - Intergenic
1101943286 12:109116713-109116735 GCTCGCCCCTCCCCGGGGTCCGG + Intronic
1101954118 12:109198612-109198634 GCCTTGACCTCCCTGGGGTCAGG - Intronic
1102868824 12:116396424-116396446 GCCTCGACCTCCCAGGGCCCAGG + Intergenic
1102917724 12:116767298-116767320 GCCTCGACCTCCCAGGGCTCAGG + Intronic
1103447149 12:121001796-121001818 GCTTCGGCCTCCCTGGGCTCAGG - Exonic
1103508877 12:121460479-121460501 GCCTCGACTTCCCAGGGCTCAGG + Intronic
1103823835 12:123720100-123720122 GCTTCGGCCTCCCAAAGGTCTGG + Intronic
1103991000 12:124799442-124799464 GCTTCGACCTCCCTGGGTTCAGG - Intronic
1104066540 12:125311516-125311538 GCTTTGAACTCCCAGGGTTCTGG + Intronic
1104235884 12:126936283-126936305 GCTTTGACCTCCCTGGGCTCAGG - Intergenic
1104859345 12:131916503-131916525 GGTCCCACCTCCGAGAGGTCGGG - Exonic
1104980391 12:132570840-132570862 GCCCCCTCCTCCCAGGGCTCAGG - Intronic
1108073750 13:46657605-46657627 GCCTCGACCTCCCTGGGCTCAGG + Intronic
1108627490 13:52245351-52245373 GCTTCAACCTCCCTGGGCTCAGG - Intergenic
1108658575 13:52561109-52561131 GCTTCAACCTCCCTGGGCTCAGG + Intergenic
1111966646 13:94868127-94868149 GCTTTGACCTCCCTGGGCTCAGG - Intergenic
1112358248 13:98692826-98692848 GCCTCGACCTCCCGGGGCTCAGG + Intronic
1113910757 13:113840160-113840182 GCTCAGACCTCCCAGGGAGTAGG + Intronic
1115319503 14:32064062-32064084 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1115993679 14:39174489-39174511 GCCTCGACCTCCCAGGGTGCTGG - Intergenic
1118194915 14:63616177-63616199 GCTGCAACCTCCCTGGGCTCAGG - Intronic
1118746365 14:68776341-68776363 GCCCCAGCCTCCCAGGGATCAGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1120814947 14:88846242-88846264 GCCTCGACCTCCCTGGGTTCAGG - Intronic
1122114878 14:99522678-99522700 CCTCCCACCTCCCACGGGTTCGG + Intronic
1122355567 14:101121149-101121171 GCGCCGTCCTCCCAGGGCTCAGG + Intergenic
1122623687 14:103073700-103073722 GCCCCGGCCTCCCAGCAGTCAGG - Intergenic
1122706588 14:103625757-103625779 CCTCCGATGTCCCAGGGGCCTGG + Intronic
1127436750 15:58965459-58965481 GCCTCGACCTCCCTGGGTTCAGG + Intronic
1128307187 15:66606465-66606487 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1129449809 15:75644856-75644878 GCTTCAACCTCCCTGGGCTCAGG - Intronic
1129450297 15:75647741-75647763 GCTCCGCCCTCCCGCGGGCCCGG - Intronic
1129625730 15:77196930-77196952 GCCTCGACCTCCCCAGGGTCAGG + Intronic
1130339393 15:82986380-82986402 GCTCCCTCCTCCCGGGCGTCCGG - Intronic
1130528067 15:84724199-84724221 GCTTCGACCTCCCAAGGTGCTGG + Intergenic
1130660385 15:85826968-85826990 GCTTTGACCTCCCTGGGCTCAGG - Intergenic
1131406473 15:92169152-92169174 GCTCCTACCTCACAGGGTTATGG - Intronic
1132821629 16:1875469-1875491 GCCTCGACCTCCCTGGGCTCAGG + Intronic
1132872000 16:2119492-2119514 GCTCCCCACTCCCAGAGGTCAGG + Intronic
1133345758 16:5069441-5069463 GCCTCGACCTCCCTGGGCTCAGG + Intronic
1133351376 16:5102939-5102961 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1134520527 16:14917404-14917426 GCTCCCCACTCCCAGAGGTCAGG - Intronic
1134551047 16:15138570-15138592 GCTCCCCACTCCCAGAGGTCAGG + Intronic
1134708199 16:16316055-16316077 GCTCCCCACTCCCAGAGGTCAGG - Intergenic
1134715414 16:16356088-16356110 GCTCCCCACTCCCAGAGGTCAGG - Intergenic
1134951403 16:18352590-18352612 GCTCCCCACTCCCAGAGGTCAGG + Intergenic
1134959343 16:18396071-18396093 GCTCCCCACTCCCAGAGGTCAGG + Intergenic
1135430593 16:22379269-22379291 GCTTCAACCTCCCAGGGCTCAGG + Intronic
1135504518 16:23024850-23024872 GCTTCAACCTCCCAGAGTTCTGG - Intergenic
1135523892 16:23198654-23198676 GCCTCGACCTCCCTGAGGTCAGG - Intronic
1136480171 16:30536175-30536197 GCCCCGACCTCCCAGGCGCCAGG - Intronic
1137672342 16:50286345-50286367 GCCTCAACCTCCCAGGGCTCAGG - Intronic
1139389338 16:66596288-66596310 GCCTCGACCTCCCAGGGTGCTGG - Intergenic
1139391358 16:66607925-66607947 GCCTCGACCTCCCCGGGCTCAGG + Intronic
1141503889 16:84462378-84462400 GCACCGGCATCCCAGGCGTCGGG + Intronic
1141613469 16:85197136-85197158 GCTCCGAGCTCCGAGGGGCCAGG - Intergenic
1142007668 16:87697399-87697421 GCCCCGGCTTCCCTGGGGTCTGG - Exonic
1142288980 16:89184094-89184116 GCTCCCACCTCCCTGGGGGCCGG + Intronic
1142412068 16:89921926-89921948 GCTCCATCCTCAGAGGGGTCTGG - Intronic
1142509467 17:385202-385224 GCTCTGATCTCCCCGGGGACGGG + Intronic
1143141927 17:4745747-4745769 GGTCGGCGCTCCCAGGGGTCGGG - Intronic
1143673779 17:8415515-8415537 GCCTCGACCTCCCTGGGCTCGGG + Intronic
1143715721 17:8767422-8767444 GCCTCGACCTCCCTGGGTTCAGG + Intergenic
1143781640 17:9232397-9232419 GTGCCCACCTCCCAGGGGACAGG + Intronic
1143781988 17:9233859-9233881 GTGCCCACCTCCCAGGGGACAGG + Intronic
1144371078 17:14592255-14592277 CCACCTAACTCCCAGGGGTCTGG + Intergenic
1145085852 17:19938812-19938834 GCCTCGACCTCCCAAGGCTCAGG + Intronic
1147380515 17:40053014-40053036 GTCTCGACCTCCCAGGGCTCAGG + Intronic
1147423996 17:40337003-40337025 GCTCCCACCTACAAAGGGTCTGG - Intronic
1148242387 17:46009115-46009137 GCCTCGACTTCCCAGGGCTCAGG - Intronic
1148617748 17:49013629-49013651 GACCCGACCTCCCTGTGGTCAGG - Intronic
1149425268 17:56548671-56548693 GCCTCGACCTCCCAAGGCTCAGG - Intergenic
1149456667 17:56793803-56793825 GCTCCCAACTCCCAGGGTGCTGG - Intronic
1150101927 17:62431433-62431455 GCTTCAACCTTCCAGGGTTCAGG + Intronic
1150497092 17:65616333-65616355 GCCTCGACCTCCCTGGGCTCAGG + Intronic
1151430702 17:74060593-74060615 CCTCCCACCTCCCAAGGCTCAGG + Intergenic
1151703527 17:75755388-75755410 CCTCTGCCCTCCCAGGGGGCGGG + Intronic
1152433040 17:80260330-80260352 GCTCGGGCCTGCCCGGGGTCTGG + Intergenic
1152536527 17:80953350-80953372 GCCTCGACCTCTCAGGGCTCAGG + Intronic
1153913579 18:9725135-9725157 GCACCCACCTCCCAAGGCTCTGG - Intronic
1154210970 18:12377791-12377813 GCATCGCCCTCCCAGGGGTCAGG - Intergenic
1154379880 18:13839236-13839258 CCACAGACCACCCAGGGGTCTGG + Intergenic
1155477000 18:26245041-26245063 GCTCCGAACTCCAAAGAGTCTGG + Intronic
1155712663 18:28902719-28902741 GCCCAGACCTCTCAGGGGTAAGG + Intergenic
1156231262 18:35155928-35155950 CCTCCCACCTGCCAGGGGTGGGG - Intergenic
1156320531 18:36017216-36017238 CCCTCGACCTCCCAGGGCTCAGG - Intronic
1158910314 18:62054572-62054594 GCTTTGACCTCCCTGGGCTCAGG + Intronic
1159767223 18:72505032-72505054 GCTTCCACCTCCCCAGGGTCTGG - Intergenic
1160159080 18:76457632-76457654 GCCTCGACCTCCCCGGCGTCAGG - Intronic
1160714926 19:572186-572208 GCCTCGACCTCCCAAGGCTCTGG + Intronic
1160892121 19:1384406-1384428 GCCCTTACCTCCCAGGGGTGGGG - Intronic
1161331882 19:3692440-3692462 GCTCTGTCCTTCCAGGGCTCAGG + Intronic
1161507982 19:4654293-4654315 GTGCCCACCTCCCAGGGGTGAGG + Exonic
1161880121 19:6943740-6943762 GCTCCGACCTCCCAAAGTGCTGG - Intergenic
1162144590 19:8605802-8605824 GCTCCCCCCTCCCAGGAGCCCGG - Exonic
1162392257 19:10396650-10396672 GCCTCGACCTCCCTGGGCTCAGG + Intronic
1162484420 19:10950272-10950294 GCCTCAACCTCCCAGGGGTCAGG - Intergenic
1162557026 19:11393468-11393490 GCTTCAACCTCCCAGGGCTCTGG + Intronic
1162654067 19:12115848-12115870 GCCTCGACCTCCCTGGGCTCCGG + Intronic
1162759459 19:12880187-12880209 GCCTTGACCTCCCAGGGCTCAGG - Intronic
1162789136 19:13054076-13054098 GCTCTGAGCTACCAGGAGTCAGG - Intronic
1163233641 19:16019291-16019313 CCTCCGCCCTCCCAGGGGTATGG - Intergenic
1163570123 19:18076483-18076505 GCCTCAACCTCCCAGGGCTCAGG + Intronic
1163862043 19:19747781-19747803 GCTCCCCCAGCCCAGGGGTCCGG + Intergenic
1164122718 19:22282861-22282883 GCCTCGGCCTCCCAGGGTTCTGG - Intergenic
1164189670 19:22902436-22902458 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1164243323 19:23409173-23409195 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1164311320 19:24048809-24048831 GCCTCGACCTCCCTGGGCTCAGG + Intronic
1165086988 19:33357127-33357149 GCCTCGACCTCCCCAGGGTCAGG + Intergenic
1165562340 19:36690506-36690528 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1165744773 19:38224181-38224203 GGTCGGTCCTCCCAGCGGTCGGG + Exonic
1166118804 19:40672526-40672548 GCTCAGAGATCCCAGGGGTCAGG - Intronic
1166251147 19:41571731-41571753 GCTCCCAGCTCCCAGGGGCCAGG - Intronic
1167027337 19:46930275-46930297 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1167414775 19:49364267-49364289 GCCTCGACCTCCCCGGGCTCAGG - Intronic
1167572198 19:50295707-50295729 GCTTCGACCTCCCTGGGCTCAGG - Intronic
1167578912 19:50330832-50330854 CCTACGACCGCCCAGGGGGCGGG - Intronic
1168228894 19:55016057-55016079 GCCTCAACCTCCCAGGGCTCAGG - Intronic
1168476486 19:56679187-56679209 GCCTCGACCTCCCAGGGTGCTGG - Intergenic
925172382 2:1758199-1758221 GCTCCCACCTGCCAGGCTTCTGG - Intergenic
925577287 2:5373457-5373479 GCTCCTCTCTCCCAGGGGGCCGG + Intergenic
925762367 2:7197961-7197983 ACTCCAGCCTCCCAAGGGTCTGG + Intergenic
925983795 2:9198521-9198543 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
926841685 2:17088131-17088153 GCTTCCACCTCCCTGGGCTCAGG - Intergenic
927299539 2:21495875-21495897 GCTTTGACCTCCCTGGGCTCAGG - Intergenic
927688534 2:25190248-25190270 GCCTCGACCTCCCAGGGCTCAGG - Intergenic
927692672 2:25219384-25219406 GCTCTGACCACCCAGGGGCTTGG - Intergenic
927860507 2:26557475-26557497 GCTCCGCTGTCCCCGGGGTCAGG + Intronic
928411573 2:31058288-31058310 GCACCCACCTCCCAGCGGGCTGG + Intronic
929200554 2:39230958-39230980 GCCTCGACCTCCCAGAGTTCTGG - Intergenic
929598620 2:43191396-43191418 GCCCCGACTTCCTATGGGTCTGG - Intergenic
931721159 2:65068743-65068765 GCCTCGACCTCCCTGGGCTCAGG - Intronic
932286075 2:70532941-70532963 GCCTCGACCTCCCTGGGCTCAGG + Intronic
932494910 2:72141432-72141454 GGTCAGACCTCCCAGAGGTGGGG + Intronic
935781055 2:106509639-106509661 GCTCCGGCCACCCAGGGAGCTGG + Intergenic
936017896 2:108973404-108973426 GCCCAGACCTCCCAGGTCTCAGG - Intronic
936119849 2:109731928-109731950 GCCTCCACCTCCCAGGGCTCAGG + Intergenic
937042672 2:118834195-118834217 TCTCCGACCGCCCAGGGCTTGGG - Intergenic
938343026 2:130548017-130548039 GCCTCGACCTCCCTGGGCTCAGG + Intronic
938346807 2:130572705-130572727 GCCTCGACCTCCCTGGGCTCAGG - Intronic
942013226 2:171785893-171785915 GCTCACACCTCCCAGTGCTCTGG - Intronic
942773053 2:179546115-179546137 GCCCCGACCTCCCTGGGCTCTGG + Intronic
943469741 2:188278858-188278880 GCTCCGTCCTCCCAGTGGAATGG - Intergenic
945073997 2:206018818-206018840 GCCTCGACCTCCCTGGGCTCAGG - Intronic
945910515 2:215643736-215643758 GCCTCGACCTCCCAGAGGGCTGG + Intergenic
946652090 2:221903544-221903566 GCTTCGACCTCCCAAAGTTCTGG - Intergenic
947358446 2:229321387-229321409 GCTCCGCCCCCCCAGGGTTCAGG + Intergenic
947638427 2:231692638-231692660 GCTCCGGCCTCCCAAGGTACTGG + Intergenic
947775161 2:232702875-232702897 GCTTTGACCTCCCTGGGCTCAGG + Intronic
948833560 2:240612924-240612946 TCCCCGACCTCCCAGGGGCGCGG + Intronic
1169089635 20:2850888-2850910 GCCATGACCTCCCAGGGCTCAGG - Intronic
1169137422 20:3205616-3205638 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1169343109 20:4810892-4810914 GCTCAGCCCTCCCACTGGTCAGG - Intronic
1169426513 20:5501408-5501430 GCTCCGGCCTCCTAAGGGGCAGG + Intergenic
1171337066 20:24394269-24394291 GCTCCCTCCTCCCTGGGATCAGG + Intergenic
1172060435 20:32183652-32183674 GCCTCAACCTCCCAGGGCTCAGG - Intergenic
1172069262 20:32244539-32244561 CCTCCCACCTCCAAGGGGTTAGG + Intergenic
1172307724 20:33893241-33893263 GCTTTGACCTCCCTGGGCTCAGG - Intergenic
1172834600 20:37864882-37864904 GCTCCTACCTCCTCTGGGTCAGG + Intronic
1173572147 20:44084283-44084305 GCCTCGACCTCCCTGGGTTCAGG + Intergenic
1174360916 20:50028522-50028544 GCCCCAACCTCCCCGGGCTCTGG + Intergenic
1174502467 20:50995852-50995874 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1174530680 20:51211113-51211135 GCTCCAACCTCCTTGGGCTCAGG + Intergenic
1175332019 20:58171616-58171638 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1175953809 20:62597719-62597741 TCCCCGAGCTCCCAGGGGCCAGG - Intergenic
1176179506 20:63742726-63742748 GCTCCGACCTCCGTGGGCTGCGG - Exonic
1176248397 20:64108506-64108528 GCCCTGACCTCCCTGGGCTCAGG + Intergenic
1178994684 21:37388165-37388187 GTTTCGACCTCCCTGGGCTCAGG + Intronic
1180137729 21:45871947-45871969 CCTCCGTCCCCCCAGGGGACGGG + Intronic
1180643915 22:17321835-17321857 GCTTCGACCTCCCTGAGCTCAGG - Intergenic
1180749786 22:18116324-18116346 GCTCTGAACTCCCAGGGCCCTGG - Intronic
1181635811 22:24174208-24174230 GCTTCAACCTCCCTGGGCTCAGG + Intronic
1182486355 22:30641338-30641360 GACTCAACCTCCCAGGGGTCAGG - Intronic
1182641330 22:31770150-31770172 GCCCCAACCTCCCAGGGCTCAGG - Intronic
1182975219 22:34617797-34617819 GCTTCGGCCTCCCAGAGGGCTGG - Intergenic
1183213452 22:36464951-36464973 GCTCCGCCCTACCAGGGAGCAGG - Intergenic
1184698741 22:46154753-46154775 GCCTCGACCTCCCTGGGCTCAGG + Intronic
1185335636 22:50269903-50269925 GCTGTGACCTCCCAGGCCTCAGG + Intronic
1185383668 22:50521871-50521893 GCCCCCAGCTCCCAGTGGTCCGG - Intronic
949460275 3:4284328-4284350 GCCTCAACCTCCCAGGGCTCAGG - Intronic
950759724 3:15210675-15210697 GCCTCCACCTCCCAGGGCTCAGG + Intronic
951712928 3:25603490-25603512 GCCTCGACCTCCCAGAGTTCTGG + Intronic
953328720 3:42034372-42034394 GCCTCGACCTCCCTGGGCTCAGG + Intronic
954605775 3:51907997-51908019 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
954695918 3:52426034-52426056 GCCCCGACCTCCCTGGGCTCAGG + Intergenic
956900969 3:73715859-73715881 GCTTCGACCTCCTATGGCTCAGG + Intergenic
958938888 3:100288161-100288183 GCCTCGACCTCCCTGGGCTCAGG - Intronic
962010446 3:131385848-131385870 GCTCTGATCTCCCAGGCGTCAGG - Intronic
962592505 3:136905705-136905727 GCCTCGACCTCCCTGGGCTCAGG + Intronic
964491800 3:157243958-157243980 GCCTCGACCTCCCAAGGCTCAGG - Intergenic
964693937 3:159485948-159485970 GTTCCTACCTCCCAGGTGCCAGG + Intronic
966404224 3:179578534-179578556 GCCTCGACCTCACAGGGCTCAGG - Intronic
967979760 3:195058776-195058798 GCTCCTGCCTCCCAGGGGTGCGG + Intergenic
967998288 3:195183366-195183388 GCACCTTCTTCCCAGGGGTCAGG - Intronic
968323355 3:197791210-197791232 TCTCCGCCCACCCAGCGGTCCGG + Intronic
968909684 4:3471335-3471357 GCTCTGACCTCCCAGCTGTATGG - Intronic
969366092 4:6695045-6695067 GCCTCGACCTCCCTGGGCTCAGG + Intronic
969384347 4:6833546-6833568 GCCTCGACCTCCCTGGGCTCAGG - Intronic
969815898 4:9687240-9687262 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
970595170 4:17593692-17593714 GCCTCGACCTCCCTGGGCTCAGG + Intronic
972291309 4:37692481-37692503 GCCCCGACCTCCCTGGGCTCAGG - Intergenic
972772211 4:42208067-42208089 GCCTTGACCTCCCAGGGCTCAGG - Intergenic
974714941 4:65656694-65656716 GCCTCAACCTCCCAGGGCTCAGG + Intronic
974906544 4:68065474-68065496 GCTCCTACCGCCCATGGATCTGG + Intronic
976402101 4:84619088-84619110 GCTCCCGCCTCCCAAGGGTGAGG + Intronic
976697057 4:87928054-87928076 GCCTTGACCTCCCTGGGGTCAGG + Intergenic
980897654 4:138875280-138875302 GCTTCGACCTCCCAAAGTTCTGG - Intergenic
982187128 4:152814170-152814192 GCCTCGACCTCCCTGGGCTCAGG + Intronic
983320918 4:166195538-166195560 GCTCCGACCTCCCAGGGTTCAGG + Intergenic
983641946 4:169951483-169951505 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
983708626 4:170688068-170688090 GCTCTCGCCTCCCAGGTGTCAGG - Intergenic
984895155 4:184532803-184532825 GCTTCGACCTCCCAGAGTGCTGG - Intergenic
987062393 5:14254820-14254842 TCTCCAACCTCCAAGTGGTCTGG - Intronic
992794999 5:80247928-80247950 GCCTCGACCTCCCTGGGCTCAGG + Intronic
995057429 5:107775951-107775973 GCCTCGACCTCCCTGGGTTCAGG + Intergenic
996571567 5:124937735-124937757 GCCTCAACCTCCCAGGGCTCAGG + Intergenic
997033451 5:130158880-130158902 GCCTCGACCTCCTAGGGCTCAGG + Intronic
997033486 5:130159244-130159266 GCCTGGACCTCCCAGGGCTCAGG + Intronic
997119139 5:131156390-131156412 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
997789898 5:136749536-136749558 GCTTCAACCTCCCTGGGCTCAGG + Intergenic
997966071 5:138357443-138357465 GCTTCGACCTCCCTGGGCTCAGG + Intronic
998116982 5:139545671-139545693 GCCTCGACCTCCCAAAGGTCTGG + Intronic
998166460 5:139847235-139847257 GCTGCCACCTCCCTGGGCTCAGG + Intronic
998166502 5:139847390-139847412 GCCCTCTCCTCCCAGGGGTCGGG + Intronic
998416682 5:141951369-141951391 GCTGCACCCTCCCAGGGGACCGG + Intronic
998848878 5:146336191-146336213 GCTCTGTCCTCTCAGGGGTCTGG - Intronic
998852546 5:146364681-146364703 GCTCTGGCCTCCCAGGGTGCTGG + Intergenic
998853653 5:146374577-146374599 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
999155859 5:149457203-149457225 CCCTCGACCTCCCAGGGCTCAGG + Intergenic
999380565 5:151118341-151118363 GCCTCGACCTCCCTGGGCTCAGG + Intronic
999770995 5:154775409-154775431 GCTTCGACCTCCCCGGGTTCAGG - Intronic
1000003483 5:157162412-157162434 GCTACAACCGCCCAGGGATCTGG - Exonic
1000489098 5:161886692-161886714 GCTTCTACCTCCCTGGGTTCAGG - Intronic
1001281713 5:170390845-170390867 GCACCCACCTCCCTGGGGGCTGG - Intronic
1001617714 5:173056499-173056521 GCTCGGAACCCCCAGGGGCCTGG + Intronic
1002015692 5:176320448-176320470 GCTTTGACCTCCCTGGGGTCAGG + Intronic
1002282936 5:178143762-178143784 GCTTCGACCTCTCAGGGCACAGG + Intronic
1002420979 5:179148932-179148954 GCTAGGACCCCCCAGGGGCCGGG - Intronic
1002530928 5:179844501-179844523 GCTTCAACCTCCCTGGGCTCAGG + Intronic
1003857197 6:10288353-10288375 CCTCCCACCTCCCAAGTGTCTGG - Intergenic
1004171559 6:13299453-13299475 GCTCTGACGTCCCTCGGGTCCGG + Intronic
1004492001 6:16126416-16126438 GCCTCGGCCTCCCAGGGCTCTGG + Intergenic
1005067968 6:21837170-21837192 GCTCCGACCTCCCTTGTGACTGG + Intergenic
1005812883 6:29530069-29530091 GCTCCCCCAGCCCAGGGGTCTGG + Intergenic
1006109295 6:31735098-31735120 GCTCCGACTTCCCTGGGCCCAGG + Intronic
1006720040 6:36144082-36144104 GCCTCGACCTCCCTGGGTTCAGG + Intronic
1008316687 6:50051147-50051169 GCCTCGACCTCCCAGGGCTCAGG - Intergenic
1008510895 6:52274604-52274626 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1010204211 6:73308590-73308612 GCCTCGACCTCCCCGGGCTCAGG + Intronic
1010702834 6:79072563-79072585 GCTTCAACCTCCCTGGGCTCAGG + Intronic
1012287090 6:97403930-97403952 GCCTTGACCTCCCAGGGCTCAGG + Intergenic
1012801963 6:103842010-103842032 GCCCCGACCTCTCTGGGCTCAGG + Intergenic
1013231392 6:108164867-108164889 GCTGCGCCCTCCCAGGGCTCGGG + Intronic
1013603403 6:111726044-111726066 GCTCTGACCACCCATGTGTCTGG - Intronic
1014201923 6:118618010-118618032 GCTCCCAACTCCAAAGGGTCAGG - Intronic
1016959927 6:149663390-149663412 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1017131440 6:151111541-151111563 GCTTCGACCTTCCTGGGCTCAGG + Intergenic
1018819221 6:167360174-167360196 GCTTCGGCCTCCCAGGGTGCTGG + Intronic
1018941634 6:168312276-168312298 GCATCGACCTCCCCGGGCTCAGG + Intronic
1018962033 6:168456052-168456074 ACTCCGCCCTCCCTGGGCTCTGG - Intronic
1019641628 7:2106537-2106559 GCTCCACTCTCCCAGGGGTGGGG + Intronic
1021503048 7:21350931-21350953 GCCTCGACCTCCCCAGGGTCAGG + Intergenic
1021548070 7:21838810-21838832 GCCTCGACCTCCCAAGGCTCAGG + Intronic
1024046093 7:45586762-45586784 CCTGCCACCTCCCAGGTGTCTGG - Intronic
1026059906 7:67016707-67016729 GCCTCGACCTCCCTGGGCTCAGG + Intronic
1026121498 7:67541915-67541937 GCTTCAACCTCCCTGGGCTCAGG + Intergenic
1026718198 7:72808366-72808388 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1027248498 7:76383626-76383648 GCCTCAACCTCCCAGGGCTCAGG + Intergenic
1028384577 7:90240196-90240218 GCCCTGACCTCCCTGGGCTCAGG - Intergenic
1028922174 7:96321461-96321483 GCTCCGCCCTCCCGCGGGTGGGG - Intronic
1029061618 7:97804363-97804385 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1029607931 7:101610157-101610179 GCCTCGGCCTCCCAGGGGCCGGG + Intergenic
1029705627 7:102274322-102274344 CCTCCCTCCTCCCATGGGTCAGG - Intronic
1030139228 7:106287719-106287741 GCTACAACCTCCCCGGGCTCAGG - Intergenic
1031836450 7:126685861-126685883 GCTCCCAGCCCCCAGGGTTCAGG - Intronic
1032031073 7:128484304-128484326 GCTTCAACCTTCCAGGGTTCAGG + Intronic
1032422739 7:131795972-131795994 GCCTCGACCTCCCCGGGCTCAGG + Intergenic
1033357814 7:140614938-140614960 GCCTCGACCTCCCTGGGCTCAGG + Intronic
1034156116 7:148957443-148957465 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1035245543 7:157560216-157560238 TCTCCCACCTTCAAGGGGTCAGG - Intronic
1035354611 7:158269477-158269499 GCCCAGACTTCCCAGGTGTCTGG - Intronic
1036611209 8:10351366-10351388 GCTCCAGCCTCCCAGGCATCTGG + Intronic
1036819346 8:11927375-11927397 GCTTCCACCTCCCAGTGTTCTGG - Intergenic
1037516808 8:19639962-19639984 GCCCAGACCTCCCTGGGCTCAGG + Intronic
1037972803 8:23186150-23186172 GCCTCCACCTCCCAGGGCTCAGG - Intergenic
1038333587 8:26628795-26628817 GCTCCTCCCTCCCAGGCTTCTGG - Intronic
1038963145 8:32544583-32544605 GCCTCAACCTCCCAGGGCTCAGG + Intronic
1039047101 8:33460270-33460292 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1039396953 8:37234511-37234533 GCCTCGACCTCCCAGAGTTCTGG - Intergenic
1039603377 8:38860875-38860897 GCTTCAACCTCCCAGAGTTCTGG - Intergenic
1040501782 8:48011425-48011447 GCTCCGGCCTCCCAAAGTTCTGG + Intronic
1040507075 8:48058487-48058509 GCTTCGACCTCCCTGGGCTCAGG - Intronic
1040650460 8:49443291-49443313 GCTTCGACCTCCCAAAGTTCTGG - Intergenic
1041673044 8:60512131-60512153 GCCCCGACCTCCCAAGGTGCTGG + Intergenic
1042568197 8:70134009-70134031 GCACCTGCCTCTCAGGGGTCTGG - Intronic
1045367413 8:101489794-101489816 GCCTTGACCTCCCTGGGGTCAGG + Intergenic
1045423385 8:102039220-102039242 TCTCAGAGGTCCCAGGGGTCAGG - Intronic
1046931079 8:119842462-119842484 GCCTCGACCTCCCCGGGCTCAGG + Intronic
1047498860 8:125427462-125427484 GCTCCGCCCACCCAGGGGCCAGG - Intergenic
1047618894 8:126586340-126586362 GCCTCGACCTCCCAAGGCTCGGG - Intergenic
1049045809 8:140150693-140150715 GCACCCACATCCCAGGGGCCTGG + Intronic
1049263198 8:141650795-141650817 GCTCTGGCCTCCCATGTGTCTGG - Intergenic
1049992781 9:1005705-1005727 GCTTCAACCTCCCTGGGCTCAGG - Intergenic
1050038605 9:1463703-1463725 GCTCTCACCTCCCAGGGAGCAGG - Intergenic
1050325446 9:4492711-4492733 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1050470954 9:5989609-5989631 GCTTCAACCTCCCTGGGCTCAGG + Intronic
1051417102 9:16853321-16853343 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1051997478 9:23235072-23235094 GCTTTGACCTCCCTGGGCTCAGG - Intergenic
1052950389 9:34205097-34205119 GCTTCGACCTCCCCAGGCTCAGG + Intronic
1052997678 9:34559806-34559828 GCTCTGCCCTCCGAGGAGTCCGG - Intronic
1053225829 9:36356094-36356116 GCCTCGACCTCCCAGGGTGCTGG + Intronic
1055446961 9:76393875-76393897 GCTCCGAGCTCCGCGGGGACGGG - Intronic
1056071864 9:82995525-82995547 GCCTCGACCTCCTAGGGCTCAGG + Intronic
1056414024 9:86359085-86359107 GCCTCGACCTCCCTGGGTTCAGG - Intergenic
1056515326 9:87344160-87344182 GCTCAGCCCTCCCAGGGCTTGGG - Intergenic
1057007574 9:91574056-91574078 GCCTCGACCTCCCAAGGCTCAGG - Intronic
1057082077 9:92180623-92180645 ACTCGGAGCTCCCAAGGGTCAGG - Intergenic
1057565136 9:96160468-96160490 GCACTGACCTCCCAGCTGTCTGG - Intergenic
1057790121 9:98119143-98119165 GCTCCGACCTCCCAGGGGTCCGG + Exonic
1057824829 9:98364381-98364403 GGTCAGGCCTTCCAGGGGTCAGG - Intronic
1058699751 9:107590368-107590390 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1058815155 9:108676242-108676264 GCCTCGACCTCCCAAGGCTCAGG + Intergenic
1060061227 9:120461758-120461780 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1060248615 9:121967470-121967492 GCTTCGGCCTCCCAAGGTTCTGG + Intronic
1061214827 9:129215637-129215659 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1061254733 9:129448102-129448124 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1061481741 9:130900833-130900855 GCTCCCAGCTTCCAGGGCTCTGG + Intergenic
1061547411 9:131312823-131312845 GCTCACACCTCCCACGGGCCTGG + Intergenic
1062491710 9:136808085-136808107 GCTCCGGCCTCCGGGGGGGCCGG + Exonic
1062544702 9:137056166-137056188 GCTCAGACCTCCCAGGGAGGGGG + Intergenic
1186221284 X:7351816-7351838 GCTCCAACTTCCCAGGGTTGTGG - Exonic
1186627497 X:11310076-11310098 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1186744599 X:12554693-12554715 GCCTCAACCTCCCAGGGCTCAGG + Intronic
1186819894 X:13276884-13276906 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1186865942 X:13720942-13720964 GCCCTGACCTCCCTGGGCTCAGG - Intronic
1187124231 X:16438488-16438510 GCCTCGACCTCCCTGGGCTCAGG - Intergenic
1188400346 X:29736474-29736496 GCTTCGGCCTCCCAGAGTTCCGG - Intronic
1188636386 X:32436868-32436890 GCCTCGACCTCCCTGGGCTCAGG - Intronic
1189231568 X:39456083-39456105 GCTCAGACTCCCCAGAGGTCTGG + Intergenic
1190452260 X:50593955-50593977 CCTGCCACCTCCCAGGGCTCTGG - Exonic
1190714521 X:53092362-53092384 CCTCCGACCTCCCAAAGTTCTGG + Intergenic
1192118821 X:68435726-68435748 GCCTCGACCTCCCTGGGCTCAGG + Intergenic
1197407402 X:126069133-126069155 GCTTCGACCTCCCAAAGTTCTGG - Intergenic
1197940734 X:131786066-131786088 GCCACGACCTCCCTGGGCTCCGG - Intergenic
1198985105 X:142442376-142442398 GCCTCGACCTCCCCGGGCTCAGG + Intergenic
1199991727 X:152991215-152991237 GCTGCAACATCCCAGGGCTCTGG + Exonic
1200233718 X:154458484-154458506 GCTCCGGCAGCCCGGGGGTCCGG + Intronic
1200279350 X:154763204-154763226 CCTCTCACCTCCCTGGGGTCCGG + Intronic
1201342928 Y:12953601-12953623 GCTCACACTTCCAAGGGGTCAGG - Intergenic