ID: 1057791257

View in Genome Browser
Species Human (GRCh38)
Location 9:98126678-98126700
Sequence AGCTGGCTGCAGAAGATGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 0, 2: 11, 3: 235, 4: 430}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057791257_1057791263 7 Left 1057791257 9:98126678-98126700 CCAGCCATCTTCTGCAGCCAGCT 0: 1
1: 0
2: 11
3: 235
4: 430
Right 1057791263 9:98126708-98126730 CTGATTCAAGAGCCGGGGTGAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1057791257_1057791266 13 Left 1057791257 9:98126678-98126700 CCAGCCATCTTCTGCAGCCAGCT 0: 1
1: 0
2: 11
3: 235
4: 430
Right 1057791266 9:98126714-98126736 CAAGAGCCGGGGTGAGGCTGGGG 0: 1
1: 1
2: 2
3: 37
4: 408
1057791257_1057791260 0 Left 1057791257 9:98126678-98126700 CCAGCCATCTTCTGCAGCCAGCT 0: 1
1: 0
2: 11
3: 235
4: 430
Right 1057791260 9:98126701-98126723 TTTCTGTCTGATTCAAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 232
1057791257_1057791264 11 Left 1057791257 9:98126678-98126700 CCAGCCATCTTCTGCAGCCAGCT 0: 1
1: 0
2: 11
3: 235
4: 430
Right 1057791264 9:98126712-98126734 TTCAAGAGCCGGGGTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 185
1057791257_1057791261 1 Left 1057791257 9:98126678-98126700 CCAGCCATCTTCTGCAGCCAGCT 0: 1
1: 0
2: 11
3: 235
4: 430
Right 1057791261 9:98126702-98126724 TTCTGTCTGATTCAAGAGCCGGG 0: 1
1: 0
2: 3
3: 25
4: 216
1057791257_1057791262 2 Left 1057791257 9:98126678-98126700 CCAGCCATCTTCTGCAGCCAGCT 0: 1
1: 0
2: 11
3: 235
4: 430
Right 1057791262 9:98126703-98126725 TCTGTCTGATTCAAGAGCCGGGG 0: 1
1: 0
2: 1
3: 20
4: 166
1057791257_1057791268 19 Left 1057791257 9:98126678-98126700 CCAGCCATCTTCTGCAGCCAGCT 0: 1
1: 0
2: 11
3: 235
4: 430
Right 1057791268 9:98126720-98126742 CCGGGGTGAGGCTGGGGCCATGG 0: 1
1: 0
2: 10
3: 109
4: 773
1057791257_1057791265 12 Left 1057791257 9:98126678-98126700 CCAGCCATCTTCTGCAGCCAGCT 0: 1
1: 0
2: 11
3: 235
4: 430
Right 1057791265 9:98126713-98126735 TCAAGAGCCGGGGTGAGGCTGGG 0: 1
1: 0
2: 1
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057791257 Original CRISPR AGCTGGCTGCAGAAGATGGC TGG (reversed) Exonic
900363963 1:2303068-2303090 AGCTGGCTGCGGACCTTGGCCGG + Exonic
900389807 1:2428977-2428999 CCCTGGCCCCAGAAGATGGCAGG - Intronic
900422503 1:2561677-2561699 AGCTGGCTGGTGACGAAGGCCGG + Exonic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
900511584 1:3063340-3063362 GGCTGGCTGGAGAGAATGGCTGG - Intergenic
901429874 1:9207139-9207161 TGCTGCCTGGAGAAGAGGGCTGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
901930940 1:12595797-12595819 AGGTGGCTGCAGAAGGGGGCTGG + Intronic
902551006 1:17219612-17219634 AGCCGGCTGAGGAACATGGCAGG + Intronic
903421438 1:23220241-23220263 AGCTGGCTGAAGGAAAAGGCTGG + Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905223713 1:36466290-36466312 AGCTAGCTGGAGAAGAGGGGAGG - Exonic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907601956 1:55780910-55780932 AGCTGGCTTCACAGGATGGTGGG - Intergenic
908277818 1:62494405-62494427 ACCTGGTTGCAGAACATGGCAGG - Exonic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913001151 1:114581950-114581972 AACTGGCTGCAGCATTTGGCGGG + Intergenic
913041001 1:115023003-115023025 AGCTGTGTGAAGAAGATGACTGG + Intergenic
914419673 1:147517859-147517881 AGCGGGTTGCAGCAGCTGGCTGG + Intergenic
915291641 1:154888146-154888168 GGCCAGCTGAAGAAGATGGCAGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918067793 1:181113237-181113259 AGCTGGCTGCCGAGGCTGCCAGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919760829 1:201097123-201097145 AGCTGGATGCAGGAGACGGTAGG - Intronic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920556353 1:206907604-206907626 AGGCGGCTGCCGAAGATGGCGGG + Intronic
921000330 1:211037582-211037604 AGCTGGTTGCATAAGATGACAGG - Intronic
922674022 1:227540254-227540276 AGCTACATGCAGAAGATGGATGG + Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924057009 1:240133755-240133777 AGATGGCTAAAGAAGATGTCTGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062925657 10:1313868-1313890 AGCTGGCTGCAGGAGGACGCTGG - Intronic
1063477746 10:6343726-6343748 ACATGGCTGCAGAAGACTGCTGG - Intergenic
1064034326 10:11902890-11902912 AGCTGGCCACTGAAGAGGGCAGG - Intergenic
1064152466 10:12876310-12876332 ACCTGGCTGCTGAAGCTGGCGGG - Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1067072630 10:43146380-43146402 AGCAGGCAGGAGAAGATGGAAGG - Intronic
1067093877 10:43285916-43285938 GGCTGGCTGCAGCCCATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067473103 10:46550041-46550063 AGCTGGGGGCAGAGCATGGCAGG + Exonic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068247197 10:54388596-54388618 AGCTAGCAGAAGAAGATGGTGGG - Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069065858 10:63941343-63941365 AGCTGGATGCAGATTGTGGCTGG + Intergenic
1069710307 10:70483605-70483627 AGCAGGATGCAGAAGCTGGCAGG - Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070793174 10:79201766-79201788 TTCTGGCTGGAGACGATGGCAGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072360467 10:94654141-94654163 AATTGTCTACAGAAGATGGCAGG - Intergenic
1073460341 10:103662134-103662156 AGCTGGGTGCAGCAGAGGGAGGG + Intronic
1073631976 10:105158431-105158453 ATCTGGCTGAAGAAGGTGGAGGG + Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1076510320 10:131009014-131009036 AGCAGGCAGAAGAAGATGGAAGG - Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077433050 11:2525599-2525621 CGCTGGCTGCATAAGCTGCCTGG - Intronic
1078408988 11:11095847-11095869 AGTTGGCTGCAGAACTGGGCTGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081445670 11:43129480-43129502 AAATGGCTGCAGAAGATGCTGGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081909825 11:46693759-46693781 AGCTGGCTGTAGCACATGACTGG - Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083315829 11:61814640-61814662 AGCGGGTTGCAGCAGCTGGCTGG + Intronic
1083659074 11:64243895-64243917 GGCTGGCTGCAGGTGATGGGAGG - Intronic
1083826151 11:65205190-65205212 AGCTGTGAGCAGAAGCTGGCAGG + Intronic
1084324210 11:68390093-68390115 ATCTGGCTGCAGGGGGTGGCTGG - Intronic
1084654336 11:70506397-70506419 AGCAGACTGCAGCAAATGGCAGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1088034796 11:105298413-105298435 ATCTCTCTGCAGAAGATGACAGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089677941 11:120102742-120102764 AGCTGTCTGCAGGGGTTGGCCGG - Intergenic
1090070980 11:123544702-123544724 TGCTGGCTTCTGAAGAAGGCAGG - Intronic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090243743 11:125201497-125201519 GGCTGGCTGGAGAAGGTGCCTGG + Intronic
1090440066 11:126718162-126718184 ATGTGGCTGCAGGAGATGGAAGG - Intronic
1091685133 12:2556194-2556216 AGGAGGCTGGAGAAGAGGGCAGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092575538 12:9778527-9778549 AGCAGGCAGAAGAAGATGGAAGG + Intergenic
1092922543 12:13245519-13245541 AGCTGTCTACAGATGACGGCAGG + Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094206771 12:27848678-27848700 AGCAGGCAGGAGAAGATGGAAGG + Intergenic
1095048072 12:37532683-37532705 AGATGTCAGCAGAAAATGGCAGG - Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095461600 12:42450017-42450039 AGCTGTGTGCTGAAGATGACAGG + Intronic
1095498642 12:42812297-42812319 GGCTGGTGGTAGAAGATGGCAGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097032658 12:56100789-56100811 AACTAGCTGCACATGATGGCAGG + Intronic
1097157941 12:57026401-57026423 TCCTGGCTGCAGGACATGGCAGG - Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1097976830 12:65695523-65695545 GGATGGCAGCAGAGGATGGCAGG - Intergenic
1098116906 12:67188632-67188654 AGCAGGCTGCAGGAGAAGGAAGG - Intergenic
1098244305 12:68500535-68500557 GGCTGGCCACAGAAGGTGGCTGG + Intergenic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099679704 12:85809975-85809997 AGCTGACTGCAGAAAATAGAAGG - Intronic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100435726 12:94569864-94569886 TCCTGCCTGCAGCAGATGGCGGG + Exonic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102801070 12:115734394-115734416 AGGTGGCTCCATCAGATGGCAGG + Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106723040 13:32455502-32455524 ACCTTGCTGCTGAAGAGGGCGGG - Intronic
1107175744 13:37395738-37395760 TGCTGGCTGCAGATCTTGGCTGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109278009 13:60323268-60323290 AGCTGGCTCCAGAAGGTTGAGGG + Intergenic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1110866949 13:80407159-80407181 TGCTGGCTGTAGATCATGGCTGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111377870 13:87404163-87404185 AGCTGGAAGCAGAAGAGAGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112303239 13:98249579-98249601 AGCTGGGTGAAGAACATGGTGGG - Intronic
1112848335 13:103672044-103672066 AGGTGGCTGCAGCACATTGCTGG - Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113433234 13:110268328-110268350 ACCTGAATGCAAAAGATGGCAGG + Intronic
1113434646 13:110281250-110281272 TTCTGGCTGTAGGAGATGGCGGG - Intronic
1113770282 13:112903913-112903935 AGGGGGCTTCAGAAGAGGGCAGG + Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115542704 14:34437685-34437707 AGCTGACTCAAGAAGGTGGCAGG + Intronic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118603951 14:67489535-67489557 TGGTGGCTGCAGAGGAGGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120094480 14:80373370-80373392 AGCTGGCTGCAAAAGATATGTGG - Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1121654871 14:95588041-95588063 GGCTGCCTGGAGGAGATGGCAGG + Intergenic
1121788534 14:96681225-96681247 AGCTGCAGGCTGAAGATGGCAGG + Intergenic
1122077907 14:99247397-99247419 AGCCAGCTGCTGAAGGTGGCAGG + Intronic
1122090936 14:99339989-99340011 AGCTGGCAGGAGAAGATTCCAGG + Intergenic
1122819772 14:104335535-104335557 AGCTGGCAGCAGAAGAGACCTGG - Intergenic
1126049473 15:44673259-44673281 AGCAGGCTGCAGAAGAGAGTTGG + Exonic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127918396 15:63474070-63474092 ACCTGCCTGAAGAAGAGGGCCGG + Intergenic
1128256427 15:66200767-66200789 AGCGGGGTGCAGAAGTGGGCCGG + Intronic
1128502124 15:68233910-68233932 ATCTGGCTGAAGAAGCTGGGAGG + Intronic
1128524650 15:68404058-68404080 AGCTGGAAGCAGCAGATGGGAGG - Intronic
1129479396 15:75811037-75811059 AGGTGGCTGCAGAGGCAGGCAGG - Intergenic
1131398714 15:92107682-92107704 TGCTGTCTGCAGAGCATGGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1131848254 15:96510874-96510896 CGCTGGCCACAGAAGATGGATGG + Intergenic
1132644354 16:991932-991954 AGCTGGATTCAGAAGCTGCCCGG + Intergenic
1132850851 16:2024264-2024286 GGCTGGCTGGAGAAGAGGCCTGG + Intergenic
1132865264 16:2090058-2090080 AGCTGGCTGGAGGAGGTGGAGGG + Exonic
1133386462 16:5374064-5374086 AGGTGCCTGCACATGATGGCAGG - Intergenic
1134671645 16:16060137-16060159 AGCTGGCAGTAGAATGTGGCAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136930073 16:34410593-34410615 AGCTGCCTGCAGTAGAGGGCTGG + Intergenic
1136974501 16:35001212-35001234 AGCTGCCTGCAGTAGAGGGCTGG - Intergenic
1137429642 16:48408306-48408328 AGTTGGATGCAGGAGATGGGAGG + Intronic
1137693549 16:50446319-50446341 ATCTGGCTGCTGGAGGTGGCTGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141019463 16:80481474-80481496 AGCAAGCTGGACAAGATGGCTGG + Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141560470 16:84864442-84864464 AGCTGGCTGGAGAATAAGCCGGG - Intronic
1142132718 16:88438230-88438252 AGCTTGCTGGAGAAGAGGCCCGG - Exonic
1142239532 16:88938907-88938929 AGATGGTTCCAGAAGCTGGCAGG + Intronic
1142593545 17:1018533-1018555 AGCTTCCTGCAGAAGCTGCCAGG - Intronic
1143720221 17:8803952-8803974 AGCTAGAGGCAGGAGATGGCAGG + Intronic
1145411337 17:22668869-22668891 AGATGTCAGCAGAAAATGGCCGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146317582 17:31820353-31820375 AGCTGCCTGCAGTAGAAGCCTGG - Intergenic
1146703639 17:34983311-34983333 AGCTGGCTGCAAAAAATGCAAGG + Exonic
1147400265 17:40176840-40176862 AGCTGGCAGCAGAAGGAAGCAGG - Intergenic
1147625478 17:41897193-41897215 AGCTGGCTGCAAGGGCTGGCCGG + Intronic
1148002489 17:44397982-44398004 AGCTGGCTGCTGAATGTGGATGG + Exonic
1148212781 17:45818281-45818303 GGCTGGCTGCAAAAGGTGACAGG - Intronic
1150573174 17:66405996-66406018 AGCTGGCTGGAGAAAAGGGAAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152417435 17:80171705-80171727 AGCTGGCTGGGGCAGTTGGCTGG + Intronic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154044625 18:10893325-10893347 ACCTGGCTGGAGCAGAAGGCTGG - Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155367686 18:25064729-25064751 GGCTGCGTGCAGAAGTTGGCGGG + Intronic
1155500204 18:26480006-26480028 AGCTGGCTCCAGACGATGTATGG + Intronic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158710465 18:59832580-59832602 AGGTGGCTGGAGAAGTAGGCAGG + Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1161456319 19:4371413-4371435 AGCTGGCTGCTGCCGATGGGCGG + Intronic
1161894870 19:7072861-7072883 AGCTGGGTGCTGGAGATGGAGGG - Intronic
1162526347 19:11209041-11209063 ACCTGGTTGCAGAACATGGCCGG - Exonic
1163170074 19:15525179-15525201 AGCTGGTTGGAGATCATGGCTGG + Intronic
1163537272 19:17883945-17883967 AGCGGGCAGCCGACGATGGCAGG - Exonic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165093874 19:33400266-33400288 TCCAGGCTGCAGAAGGTGGCTGG + Intronic
1167620550 19:50557668-50557690 AGCAGGTTTCAGAAGAGGGCTGG + Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925960400 2:9009145-9009167 AGCTGGCAGCAGAAGAGGGTGGG - Intergenic
926343870 2:11927804-11927826 AGCTCCCTGCAGAAGCTGGGTGG - Intergenic
926367163 2:12144000-12144022 ATGTGGCTGGAGAAGAAGGCAGG + Intergenic
926450370 2:12996425-12996447 AGGTGGATTCAGAGGATGGCTGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927857821 2:26538224-26538246 GGGTGGCTGCAGAAGGAGGCTGG - Intronic
928281361 2:29949248-29949270 AGATGGCTGCTGAAGGAGGCAGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931707887 2:64962593-64962615 AGCAGGCAGCAGAAGGTGGAAGG - Intergenic
931812111 2:65864091-65864113 AGCAGTGTGCAGAAGATGGCAGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
935277326 2:101486198-101486220 GGCTGGCTGAAGAAGATGGAGGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935787661 2:106563548-106563570 AGGTGACTGCAGAAGAGGCCAGG - Intergenic
935987104 2:108685975-108685997 CTCTGGCTGCAGGAGATGCCTGG - Exonic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG + Intergenic
938775753 2:134540012-134540034 AGCAGGGAGCAGAAGATGGAAGG + Intronic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940072353 2:149702840-149702862 AGCAGGCTTCAAAAGTTGGCAGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946973611 2:225123057-225123079 AGCAGGTTGCAGCAGAGGGCTGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948251870 2:236536003-236536025 AGGTGGGTGCAGAGGATGGTGGG + Intergenic
948295177 2:236855334-236855356 AGCTGCCTGGAGAAGATGCCTGG - Intergenic
1168890493 20:1292810-1292832 AGGTGGCAGCAGAAAATGGGAGG - Intronic
1169861480 20:10157626-10157648 AGCTTGCTGCAGAAAATTACTGG - Intergenic
1170155148 20:13262331-13262353 AACTGGATGCTGAGGATGGCTGG + Intronic
1170351534 20:15447255-15447277 AGCTGGCTGCAAGCTATGGCAGG + Intronic
1170351591 20:15447587-15447609 AGCTGGGTGGAGATTATGGCAGG - Intronic
1170368062 20:15618702-15618724 CCCTGGCTGCAAAAGATGGGAGG + Intronic
1170621449 20:17999804-17999826 TGCAGGCTGCAGAAGTGGGCGGG + Intronic
1171542616 20:25976153-25976175 AGATGTCAGCAGAAAATGGCAGG - Intergenic
1171798444 20:29584370-29584392 AGATGTCAGCAGAAAATGGCAGG + Intergenic
1171845651 20:30272803-30272825 AGATGTCAGCAGAAAATGGCAGG - Intergenic
1174035375 20:47665477-47665499 GGCTGGCTGGAGGAGAAGGCGGG - Intronic
1174654237 20:52157023-52157045 AGCTGGCTGGAGAAGCTGGCTGG - Intronic
1175258641 20:57661727-57661749 GGCTGGTGGCAGGAGATGGCTGG - Intronic
1176422631 21:6528195-6528217 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178389924 21:32189793-32189815 GGGTGGATGCAGAGGATGGCAGG - Intergenic
1178983751 21:37285837-37285859 AGCTGGCTCCAGAGTGTGGCAGG + Intergenic
1179055145 21:37924819-37924841 AGCTGGTAGCAGAAGATGTCAGG - Intergenic
1179177323 21:39018263-39018285 TGTAGGCTGCAGAAGATAGCTGG - Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179488222 21:41724402-41724424 TGCTGGCTGCAGAAGAGTGCTGG - Intergenic
1179698124 21:43136511-43136533 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1180140327 21:45889569-45889591 GGCGGGCTGCAGAAGAAGGGAGG - Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1181443695 22:22952280-22952302 AGCTGATGGCAGAAGATGGAAGG - Intergenic
1183294014 22:37019431-37019453 GGCCGGCTGGAGAAGTTGGCCGG + Exonic
1183388597 22:37529869-37529891 CGCTGGGTGCAGCAGCTGGCAGG + Intergenic
1183961132 22:41412639-41412661 AGCTGACAGCAGGCGATGGCAGG - Intergenic
1183982811 22:41552241-41552263 AGGTGGGTGGAGAACATGGCTGG - Intergenic
1184109504 22:42386854-42386876 AGCTGCCACCAGGAGATGGCTGG + Intronic
1184117144 22:42428835-42428857 AGCTGTCACCAGAAGAAGGCAGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1185130360 22:49035399-49035421 AGCGGGCTGCTGAGGAGGGCAGG - Intergenic
1185171655 22:49297949-49297971 AGCTGGCTGCAGAGCCAGGCGGG + Intergenic
1185215642 22:49598629-49598651 AGCTGGGGGCAGCAGATGCCAGG - Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952519243 3:34138683-34138705 AGTTGGGTCTAGAAGATGGCTGG - Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954317726 3:49810393-49810415 AGGTGGCTGCAGCAGCTGCCCGG - Exonic
954395321 3:50290352-50290374 AGCTGGGTGTAGGAGTTGGCTGG + Intronic
954397479 3:50300619-50300641 AGCTGGATGGAGAAACTGGCAGG + Exonic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955727075 3:61944466-61944488 AGCTGGCTGCAGTGGAAGTCTGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957243480 3:77688939-77688961 ACCTGCCTGGAGAAGCTGGCTGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961466189 3:127083084-127083106 AGATGCCTGCAGAAGAAGGGGGG - Intergenic
961639595 3:128356984-128357006 TGCTTGCTGGAGAAGATGTCAGG - Intronic
962900106 3:139754480-139754502 AGCTGGCTGCTGAGGCTGCCAGG - Intergenic
963599840 3:147369260-147369282 AGCTTGCTGCAGACGCTTGCAGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970834383 4:20384267-20384289 AGCTAGCTGCAAAAGATCCCAGG + Intronic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971780593 4:31029318-31029340 AGCTTGCTTCTGAAGATGGTGGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973143678 4:46798576-46798598 AGCTTTCTGCAGATCATGGCAGG - Intronic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978367209 4:107994984-107995006 AGCTGGAGGCAGAACATGGCAGG - Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981944313 4:150323557-150323579 AGCTTGCTGTGGAAGGTGGCTGG - Intronic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982489156 4:156006734-156006756 AGCTGGCTGAATGAGATGGAGGG + Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988698627 5:33649683-33649705 TGCTGGATGCCGAAGCTGGCAGG + Exonic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993363089 5:87002119-87002141 TGGTGGATGAAGAAGATGGCTGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
993853601 5:93042470-93042492 AACTTGCTGCAGAAGATAGATGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995945477 5:117639788-117639810 AGCTGACTACAGAGGATGACAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998747167 5:145273802-145273824 AGCTTCCTCCAGAAGGTGGCAGG + Intergenic
999045934 5:148469536-148469558 AGCTGGCTTCAGAATGTGCCAGG - Intronic
999123018 5:149224561-149224583 AGGGGGCTGCAGCACATGGCAGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001280246 5:170381588-170381610 AGCAGGCTGCAGGAGCTGGGAGG - Intronic
1001361470 5:171090533-171090555 AGCTGGCTGCAGAAGTAAGGAGG + Intronic
1001698441 5:173689862-173689884 AGCCGGCTGCAGCAGCGGGCAGG - Intergenic
1001793342 5:174480370-174480392 AGCTGGCAGGAGAGGATGGCTGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003060504 6:2858802-2858824 ATCTGGCAGCAGAAGGAGGCTGG - Intergenic
1003645919 6:7912673-7912695 ACCTGGATGCTGAAGATGCCAGG - Intronic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006458900 6:34146660-34146682 AGCTGGGGGAAGAAGGTGGCAGG + Intronic
1007183098 6:39944914-39944936 AGCAAGGTGCAGAAGATGGAGGG - Intergenic
1007509788 6:42366110-42366132 AGCAGACTGCAGGAGAGGGCTGG - Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011519322 6:88187252-88187274 AGCTGGCTGCAGAGGCTGATTGG - Intergenic
1011645994 6:89458634-89458656 AGCTGGCAGGAGAAGATGGAAGG - Intronic
1012131687 6:95501071-95501093 AGCTGGCTGGAGAAGCTGGCTGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013082944 6:106828593-106828615 TGCTGGAGGCAGATGATGGCAGG - Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013422348 6:109978363-109978385 AGCTGCCTGCAGGAGGCGGCCGG - Exonic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014538833 6:122649790-122649812 AGCTGTCTTCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015879003 6:137852206-137852228 AGCTGGCAGGAGATGTTGGCTGG - Intergenic
1016050301 6:139523639-139523661 AGCTGGTTGGAGAAGAGGGGTGG + Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016435751 6:144035458-144035480 AGCAGGCAGGAGAAGATGGGAGG - Intronic
1017357633 6:153528428-153528450 AGCTGGCAGAAGAAGGTGGAAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018469531 6:164083353-164083375 TGCAGACTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1018924809 6:168198632-168198654 AGCTGCCTGCAGAGGATGCACGG + Intergenic
1019125569 6:169838216-169838238 ACCTGGCCCCAGAAGAAGGCTGG - Intergenic
1020016722 7:4835745-4835767 AGCTGGCTGCACAGGAGGGCGGG + Intronic
1020019825 7:4857520-4857542 AGCTGAATCCAGAAGAAGGCAGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022177722 7:27887864-27887886 AAGTGGCTGCAGAAGATGCTGGG + Intronic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1023768204 7:43531625-43531647 AGCTGGCTGGAGAGAATGGGAGG - Intronic
1023874516 7:44279507-44279529 AGCTGGCTGCTGAGAATGCCAGG + Intronic
1023920188 7:44623103-44623125 GGCTGAGTGCAGAAGGTGGCAGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG + Intergenic
1025961017 7:66221621-66221643 AGCTGGCTGCAGATGAAGCAGGG + Intronic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026400369 7:70005666-70005688 AGCTGGCTGCTGAAGAAGAGAGG + Intronic
1026870646 7:73849208-73849230 AGATGGCTCCAGAAGGCGGCAGG + Intergenic
1027240959 7:76328544-76328566 AGCTGGGTGCAGAAGCTGTGGGG - Exonic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028136879 7:87231333-87231355 CGCTGGCTGCTGCAGTTGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029686902 7:102154926-102154948 AGCTGGCTGCAGAACTTGGGAGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032427279 7:131832185-131832207 CTCTGGCTGCAGAAGCTAGCTGG - Intergenic
1032515486 7:132503455-132503477 AGCTGGCTGGAGAAGATGCTGGG - Intronic
1033027556 7:137790676-137790698 AGCAGGACTCAGAAGATGGCTGG + Intronic
1033615304 7:143008523-143008545 CACAGGCTGCAGAACATGGCTGG + Intergenic
1035161031 7:156950023-156950045 CGCCGGCTGCAGAGGACGGCGGG + Exonic
1036758545 8:11490389-11490411 CTCTGGCAGCAGAAGATGGGAGG - Intergenic
1037349726 8:17938960-17938982 AGGTGTCTGAAGAAGATGGGAGG + Exonic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037510797 8:19579900-19579922 AGCTGGATGAAGAAGAAGGAAGG + Intronic
1037893052 8:22634102-22634124 AGCTGTCTGCAGAAGCAGGAAGG + Intronic
1039096268 8:33889598-33889620 AGCTGGCAGGAACAGATGGCTGG - Intergenic
1040280442 8:46039355-46039377 AGATGGCTGCAAAAGTGGGCCGG - Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042606575 8:70552316-70552338 AGCAGGATGAACAAGATGGCAGG - Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1043931540 8:86097119-86097141 AGCTTGCAGCAGACCATGGCAGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044350935 8:91165862-91165884 AGTTGGCTGTAGAAGAATGCAGG + Intronic
1044757671 8:95481807-95481829 TGCTGGCTGCAGGAGCTGACTGG + Intergenic
1045016957 8:98008648-98008670 AGCTGGCTGCAGCAGCAGTCTGG - Intronic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048153151 8:131914099-131914121 AGCCAGCTGCAGCAGATGGTGGG - Intronic
1048236200 8:132693092-132693114 AGGTGGCTGCAGCAGCAGGCTGG + Intronic
1049140597 8:140950476-140950498 AGCTGGCTGTGCAAGGTGGCTGG + Intronic
1049151977 8:141040919-141040941 TTCTAGCTGCAGAAGCTGGCAGG + Intergenic
1049441471 8:142611716-142611738 AGTCGGCTGCAGCAGAGGGCAGG - Exonic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051368625 9:16339429-16339451 AGCTGACTGCGGAAGCTGCCCGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052273360 9:26651264-26651286 AGCTGGCTGTTGCAGCTGGCTGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052746540 9:32447540-32447562 AGCAGGCTTCAGAAGGTGGGTGG - Intronic
1054162426 9:61683043-61683065 AGATGTCAGCAGAAAATGGCAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056078840 9:83068861-83068883 GGCTGGTTGCAGAACATGACAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057222007 9:93262524-93262546 ACCTGGCTGCAGAAGAGAGCAGG + Intronic
1057791257 9:98126678-98126700 AGCTGGCTGCAGAAGATGGCTGG - Exonic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058713628 9:107703024-107703046 AGCTGGTGGCAAAAGATGCCTGG - Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059993790 9:119890275-119890297 GTCTGGTAGCAGAAGATGGCAGG + Intergenic
1060269679 9:122131823-122131845 CGCTGATTGCAGGAGATGGCAGG - Intergenic
1061250853 9:129425499-129425521 AGCTGCCTGCAGCAGATCCCAGG - Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062135904 9:134928210-134928232 AGCAGGCAGAAGAAGATGGAAGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1193979192 X:88159952-88159974 AGCAGGCAGGAGAAGATGGAAGG + Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194693596 X:97017066-97017088 AGCTGCCTGAAGAAAATTGCAGG + Intronic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196680167 X:118462336-118462358 AGCAGGCTGGACAACATGGCGGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198428997 X:136547143-136547165 AGCCGGCTGGAGAGGATGTCTGG - Intronic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199826725 X:151507768-151507790 AGCTGTCTGCAGTAGATTACAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG + Intergenic
1200962879 Y:9011220-9011242 GGGTGTCTGCAAAAGATGGCTGG - Intergenic
1201024193 Y:9690595-9690617 AGGTGTCTGCAAAAGATGGCTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202137951 Y:21686771-21686793 ATTTGTCTACAGAAGATGGCAGG - Intergenic
1202150227 Y:21837561-21837583 GGGTGTCTGCAAAAGATGGCTGG + Intergenic
1202177213 Y:22108819-22108841 AGTTGTCAGCAAAAGATGGCCGG + Intergenic
1202214148 Y:22477565-22477587 AGTTGTCAGCAAAAGATGGCCGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic