ID: 1057791293

View in Genome Browser
Species Human (GRCh38)
Location 9:98126841-98126863
Sequence GTGGGCACCCCGTCCTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057791293_1057791304 16 Left 1057791293 9:98126841-98126863 CCATGTGAGGACGGGGTGCCCAC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1057791304 9:98126880-98126902 GGGGCACCAATGACACAGGCAGG 0: 1
1: 0
2: 3
3: 15
4: 148
1057791293_1057791301 -4 Left 1057791293 9:98126841-98126863 CCATGTGAGGACGGGGTGCCCAC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1057791301 9:98126860-98126882 CCACGGGAAGATGGGCATATGGG 0: 1
1: 0
2: 0
3: 13
4: 95
1057791293_1057791303 12 Left 1057791293 9:98126841-98126863 CCATGTGAGGACGGGGTGCCCAC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1057791303 9:98126876-98126898 ATATGGGGCACCAATGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 89
1057791293_1057791302 -3 Left 1057791293 9:98126841-98126863 CCATGTGAGGACGGGGTGCCCAC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1057791302 9:98126861-98126883 CACGGGAAGATGGGCATATGGGG 0: 1
1: 0
2: 1
3: 10
4: 115
1057791293_1057791299 -5 Left 1057791293 9:98126841-98126863 CCATGTGAGGACGGGGTGCCCAC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1057791299 9:98126859-98126881 CCCACGGGAAGATGGGCATATGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057791293 Original CRISPR GTGGGCACCCCGTCCTCACA TGG (reversed) Intronic
900557821 1:3288980-3289002 GTGCTCACCACCTCCTCACAGGG + Intronic
900567011 1:3338507-3338529 CCGGGCACCCCGTCCCCACTTGG - Intronic
901801318 1:11709634-11709656 GTGGGTGCCCCATCCTGACAAGG + Intronic
902117669 1:14135215-14135237 GTGGGCAAGGCCTCCTCACAGGG - Intergenic
902520134 1:17011405-17011427 GTGGCCTCCCCGTCCCCGCACGG + Intronic
902545367 1:17186429-17186451 GCTGGCACCCCGTGCTCCCAGGG + Intergenic
904288949 1:29471425-29471447 AATGGCACCCCCTCCTCACAGGG + Intergenic
904418189 1:30375414-30375436 GGGGGCACCCAGTGATCACAGGG + Intergenic
906129972 1:43450240-43450262 GTGGGCACCCCAACCTCAGCAGG - Intronic
907273302 1:53303294-53303316 GGGAGCAGCCAGTCCTCACAGGG + Intronic
920253141 1:204635910-204635932 GTTGGCACATCGCCCTCACAGGG + Intronic
921885520 1:220301044-220301066 GTGGCCACCCCTTCCAGACATGG - Intergenic
923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG + Intronic
1062804721 10:409330-409352 GTGCACACACCGTCGTCACAGGG + Intronic
1063361758 10:5465152-5465174 GTGGACACTTTGTCCTCACATGG - Intergenic
1068594467 10:58888009-58888031 TTGGGCTTCCCTTCCTCACATGG + Intergenic
1069593176 10:69654490-69654512 GGGGGCACCCCCTCCTCTCTGGG - Intergenic
1071398889 10:85250135-85250157 GTGAACACAGCGTCCTCACATGG + Intergenic
1071875295 10:89837611-89837633 GAGGACACTCCGACCTCACATGG - Intergenic
1072703524 10:97662671-97662693 CTGGGCTCCACGTCCTCCCATGG + Intronic
1077391049 11:2300809-2300831 GTGGGCAGCCCGTCCTCTCCAGG - Intronic
1081777092 11:45683069-45683091 TTGGGCAGCCCATCCCCACAGGG + Intergenic
1085519243 11:77128486-77128508 GTGGGCAGCCCATCCTTACCTGG - Exonic
1087655861 11:100922221-100922243 CTGTGCTCCCCTTCCTCACAGGG + Intronic
1088719140 11:112576514-112576536 GTGGGCCCACCACCCTCACAGGG + Intergenic
1089372882 11:117973781-117973803 GTGAGCACCCAGTAATCACAAGG + Intergenic
1091196047 11:133731462-133731484 GTGTGCAGCCAGTCCTCACTAGG + Intergenic
1096768369 12:53913749-53913771 GACGGCACCCCAGCCTCACAAGG + Intergenic
1097046084 12:56189003-56189025 TTGGGCACCCGGTCCACACCCGG + Intronic
1098205581 12:68105915-68105937 GTGGGCCCAATGTCCTCACAAGG + Intergenic
1102160323 12:110763630-110763652 GTGGGCACCCATTCCACTCACGG - Intergenic
1103342477 12:120228476-120228498 GTCTGCACCCCTTCCTCACCAGG - Intronic
1103518236 12:121521143-121521165 GTGGGCTCCCACACCTCACAAGG + Intronic
1104091740 12:125523445-125523467 GTGGGCCCCATGTCATCACAAGG - Intronic
1104522467 12:129488046-129488068 GAGGACACCATGTCCTCACAAGG - Intronic
1105533049 13:21237389-21237411 GAGGGCACCCCACCCACACATGG + Intergenic
1113914535 13:113862910-113862932 GTGGCCAGGCCGTCCTCACACGG + Intronic
1115592268 14:34875191-34875213 GGGGAGACCCCGTCCTCCCAGGG + Exonic
1118373804 14:65159577-65159599 GGGGGCACCCAATGCTCACATGG - Intergenic
1118813345 14:69291481-69291503 GTGGGGACCCTGACCTCACTGGG - Intronic
1119685476 14:76627624-76627646 GTCAGCACTCTGTCCTCACATGG + Intergenic
1120340660 14:83217069-83217091 GTGGGCTCCCCTTTGTCACAGGG + Intergenic
1122540964 14:102497448-102497470 ATGGGCACTCCGTCCCCGCAGGG + Intronic
1124694696 15:31854275-31854297 GTGGGCCCCAGGTCATCACAAGG - Intronic
1125472843 15:40021473-40021495 GTGGGCCCCACGTAATCACAGGG - Intronic
1128033222 15:64499988-64500010 CTGACCACCCCGTCCTCCCAAGG - Exonic
1128617532 15:69121773-69121795 GTGGGGACCCCAAGCTCACAGGG + Intergenic
1132246571 15:100300712-100300734 GAGGGCACCACATCATCACATGG + Intronic
1132653530 16:1032026-1032048 GTGGGCCCCAAATCCTCACAGGG - Intergenic
1133103564 16:3493516-3493538 GTGGGCTCCCCGGCCTCTCAGGG + Exonic
1140874299 16:79136659-79136681 GTGGGCACCAGTTCCTCACCGGG + Intronic
1141095695 16:81161315-81161337 GTGGGCTCCGCGTCTTCCCAGGG - Intergenic
1142259695 16:89036904-89036926 GTGGGCACCCTGCCCTCAGAGGG - Intergenic
1142991222 17:3732374-3732396 TTGGTCACCCCGTCCTCAAGAGG - Exonic
1144234426 17:13243756-13243778 GTGGCCATCCCTTTCTCACAGGG - Intergenic
1148965508 17:51431641-51431663 GTGAGCACCCCAACCTCACTAGG - Intergenic
1149229669 17:54518774-54518796 GTGGCCACCCCTTCCCCTCAGGG + Intergenic
1150139867 17:62718538-62718560 CTGGGCAACCCATCCTCACGTGG + Intronic
1153706215 18:7748381-7748403 GGGGGCACTCCCTCCTCACAAGG - Intronic
1153922695 18:9805504-9805526 GTGGGCCCAGTGTCCTCACAAGG - Intronic
1155311976 18:24532913-24532935 AAGGGCACCCAGTCCTCCCAGGG + Intergenic
1158653671 18:59309294-59309316 GTGGGGACCCCCTCCTCCAAGGG - Intronic
1160572355 18:79827035-79827057 GGGGACGCCACGTCCTCACAAGG - Intergenic
1160775242 19:852476-852498 GTGGGTCCCTCATCCTCACAGGG + Intronic
1160853434 19:1205700-1205722 GTGGGCACGTCGTCCTCGCGAGG + Intronic
1160854801 19:1211952-1211974 GAGGACACCCAGGCCTCACATGG - Intronic
1163548500 19:17952534-17952556 GCAGGAACCCCCTCCTCACAGGG - Intronic
1166996703 19:46722935-46722957 GTGGGGACCCCGTGCTCTGAGGG + Exonic
1168115681 19:54220392-54220414 GAGGGCACCCAGCCCTCAGAGGG - Intronic
1168118668 19:54240138-54240160 GAGGGCACCCAGCCCTCAGAGGG - Intronic
1168273922 19:55265830-55265852 GTGGGGGCCCCGTCCTCTCAAGG - Intronic
928620415 2:33082870-33082892 GTGGGCATCTGGTCCTCACTGGG + Intronic
937276416 2:120686918-120686940 GTGCGAACCCCCTCCTCCCAGGG - Intergenic
939022922 2:136980374-136980396 GTGGCCACCCCCTCCCAACAGGG + Intronic
946080661 2:217115792-217115814 GTGGGCTGCCCATCCTCTCATGG + Intergenic
948679714 2:239625587-239625609 GTGGGCACCGGGTCCTTGCAGGG + Intergenic
948835404 2:240623919-240623941 TGGGGCACCCCGTCCCCACCAGG - Intronic
1168954983 20:1828420-1828442 GTGGGCACCCAGCCCTTACCTGG + Intergenic
1170957043 20:20991153-20991175 GTTCTCACCGCGTCCTCACATGG + Intergenic
1173993371 20:47319831-47319853 GTGGGCAGTGCGTTCTCACAGGG - Intronic
1174547301 20:51334915-51334937 GTGGTCACCCCGACCACAAATGG - Intergenic
1175895639 20:62334499-62334521 GTGGGTACCCCTTCCCCACTGGG - Intronic
1175916705 20:62429349-62429371 GTGGGGAGCCCTGCCTCACAAGG + Intergenic
1175942352 20:62543306-62543328 GTGGGCCCAGTGTCCTCACAGGG - Intergenic
1176295172 21:5068091-5068113 GTGGGCGCCAGGTCATCACAGGG - Intergenic
1179784096 21:43719885-43719907 GTGGGCACCGTGACCTCACTCGG - Intronic
1179861877 21:44194037-44194059 GTGGGCGCCAGGTCATCACAGGG + Intergenic
952005866 3:28841702-28841724 GTGGGCTCCCCCTCCTGAGAAGG - Intergenic
960950436 3:122995411-122995433 GTGGCCACCCTGTCATCCCAGGG - Intronic
961739024 3:129020915-129020937 GTGGGCACCTCGTAGTCCCAGGG + Intronic
962197476 3:133376676-133376698 GTGGGCACCTCAAACTCACAGGG - Intronic
969277671 4:6147829-6147851 ATGGCCACCCTGGCCTCACAGGG + Intronic
971441283 4:26689921-26689943 TTGGGCATGCCGTCCTCACTAGG - Intronic
983216602 4:165008021-165008043 GGGGGCACACTGTCCTCAGATGG + Intergenic
984955401 4:185040540-185040562 GTGGCCACTCTGTCCTCACAGGG - Intergenic
985676131 5:1232198-1232220 CTGACCACCCCCTCCTCACAGGG + Exonic
985911052 5:2883666-2883688 GTGGGCTGCCCTTCCTCACAAGG - Intergenic
1002697372 5:181099919-181099941 GTGTCCACCCAGTCCTCACCTGG - Intergenic
1003389204 6:5698825-5698847 GAGGGCACCCCACCCACACATGG - Intronic
1006392239 6:33765323-33765345 GTGGGCACCTGCTCCACACAGGG + Intergenic
1013298312 6:108780164-108780186 GTGGGCACCCAGACGTCCCATGG - Intergenic
1019322740 7:422975-422997 GTGGGTGCCCCTTCCTCACTAGG - Intergenic
1020746796 7:12089610-12089632 GTGGGCACCCGGTACTCAAGAGG - Intergenic
1021296500 7:18914131-18914153 CTTGTCACCACGTCCTCACATGG - Intronic
1021575080 7:22099268-22099290 GAAGGCACCCCATCTTCACATGG + Intergenic
1025003372 7:55336857-55336879 GTGGGCTCCCCCTCCTAAAAGGG - Intergenic
1028386368 7:90258552-90258574 GTGGGCCCACCGTAATCACAGGG - Intronic
1029117501 7:98244833-98244855 GGAGGCACCCCCTCCCCACAGGG + Intronic
1034477369 7:151293486-151293508 GGGAGCACCCCAGCCTCACAGGG + Intergenic
1035260933 7:157661375-157661397 GTGGGCACACCCTTCTCCCACGG - Intronic
1035372382 7:158387632-158387654 GTGGCCACCGCGTCTTCCCAGGG - Intronic
1035454951 7:159002029-159002051 TTGTGCAGCCCCTCCTCACACGG - Intergenic
1035594357 8:843494-843516 GTGGGCACCACGGCCTCTCCTGG + Intergenic
1036152638 8:6312958-6312980 GTGGGCCCAATGTCCTCACAAGG + Intergenic
1037428553 8:18784762-18784784 GTGGGCATCCCAACATCACAGGG - Intronic
1043999733 8:86865168-86865190 GTGTGCTCCCCCTCCCCACAGGG - Intergenic
1047513028 8:125529812-125529834 GTGGGCACCCTCTCCCCACCTGG - Intergenic
1047662498 8:127052663-127052685 GTGGGCAATCTGTCCTCTCAAGG + Intergenic
1049617882 8:143583845-143583867 GTGGGCCCACTGTCATCACAAGG + Intronic
1056665441 9:88577571-88577593 GTGGACACTGTGTCCTCACATGG + Intronic
1056729628 9:89154429-89154451 TGGGGCATCCCCTCCTCACAGGG - Intronic
1057791293 9:98126841-98126863 GTGGGCACCCCGTCCTCACATGG - Intronic
1060219566 9:121757191-121757213 GTGGACACCCCATCCTCTCCTGG + Intronic
1062195124 9:135268848-135268870 GTGGGAACCCTGCCCTCCCACGG + Intergenic
1200145546 X:153924563-153924585 GTGGCCACCCCGCCCTCACATGG - Intronic