ID: 1057791422

View in Genome Browser
Species Human (GRCh38)
Location 9:98127459-98127481
Sequence CAGAGTGGGCAGAGGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057791413_1057791422 14 Left 1057791413 9:98127422-98127444 CCGTGTTGGCAGGAGCGGGAGAG 0: 1
1: 0
2: 2
3: 32
4: 203
Right 1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG No data
1057791411_1057791422 16 Left 1057791411 9:98127420-98127442 CCCCGTGTTGGCAGGAGCGGGAG 0: 1
1: 0
2: 2
3: 7
4: 116
Right 1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG No data
1057791410_1057791422 17 Left 1057791410 9:98127419-98127441 CCCCCGTGTTGGCAGGAGCGGGA 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG No data
1057791412_1057791422 15 Left 1057791412 9:98127421-98127443 CCCGTGTTGGCAGGAGCGGGAGA 0: 1
1: 0
2: 0
3: 19
4: 233
Right 1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057791422 Original CRISPR CAGAGTGGGCAGAGGGACCT GGG Intronic
No off target data available for this crispr