ID: 1057799037

View in Genome Browser
Species Human (GRCh38)
Location 9:98178596-98178618
Sequence AAGGGGAAACACTCTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057799037_1057799046 20 Left 1057799037 9:98178596-98178618 CCTTTCTCAGAGTGTTTCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 330
Right 1057799046 9:98178639-98178661 CACATGAGACAGGAGACTCCTGG No data
1057799037_1057799041 -5 Left 1057799037 9:98178596-98178618 CCTTTCTCAGAGTGTTTCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 330
Right 1057799041 9:98178614-98178636 CCCTTCTCTCTGGAGACTCCTGG No data
1057799037_1057799043 10 Left 1057799037 9:98178596-98178618 CCTTTCTCAGAGTGTTTCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 330
Right 1057799043 9:98178629-98178651 ACTCCTGGACCACATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057799037 Original CRISPR AAGGGGAAACACTCTGAGAA AGG (reversed) Intronic
900982362 1:6053490-6053512 GAGGGGGAACCCTCTGAGAGAGG + Intronic
904376832 1:30086840-30086862 CAGGGGAAAGACGATGAGAAGGG + Intergenic
904572683 1:31478651-31478673 AAATAAAAACACTCTGAGAAGGG - Intergenic
905556343 1:38888029-38888051 AAGGAAAAACACCCTGATAAAGG + Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905971971 1:42148701-42148723 ATGGGGAAACTCTCTGAGGGAGG + Intergenic
906740456 1:48177856-48177878 AAGGGGAAACTCTGTGGGAGGGG + Intergenic
907159381 1:52359641-52359663 TAGGGGAAACAGGCTCAGAAAGG - Intronic
907529633 1:55081674-55081696 AATGGGAAAAACTCTGAGGCTGG + Intronic
908386244 1:63644334-63644356 AAGGTAAAACACTCTGGGCAAGG - Intronic
908701366 1:66905628-66905650 AAGGGGAAACATTCCTACAATGG + Intronic
908770655 1:67592738-67592760 TGAGGGAAACATTCTGAGAAGGG + Intergenic
909551702 1:76905206-76905228 AGGGGTAGAGACTCTGAGAAAGG + Intronic
909568363 1:77080592-77080614 AAGGGGAGCCACCTTGAGAATGG + Intergenic
909793520 1:79703288-79703310 AAGGGGAAAGACTGTATGAAGGG - Intergenic
911973774 1:104466502-104466524 ATAGGGAAGCACTCTTAGAAGGG - Intergenic
912813407 1:112810612-112810634 AAGGGTAAAGACACAGAGAAGGG - Intergenic
912977877 1:114346302-114346324 AGGGGGAAAAGCTCTGGGAAAGG + Intergenic
913251289 1:116913615-116913637 CAGGGGAAACAATCAGAGTAGGG - Intronic
914347223 1:146810187-146810209 AAGCAGAAACACTCTGAAAAAGG - Intergenic
915022492 1:152794597-152794619 TAGGAGACACACTCTGAGACAGG - Intronic
915023233 1:152801813-152801835 TAGGAGACACACTCTGAGACAGG - Intronic
915470459 1:156122893-156122915 AAGGGGAAAGAGTTTGGGAAGGG + Intronic
916203501 1:162294076-162294098 AAGGGGGAAGCATCTGAGAAAGG + Intronic
916996795 1:170309876-170309898 AAGGGGAAACAGTCTCAGTAGGG - Intergenic
917020206 1:170578790-170578812 AAAGGGAAACAGACAGAGAAGGG - Intergenic
918102488 1:181388352-181388374 ACAGGGATACATTCTGAGAAAGG + Intergenic
918517181 1:185375954-185375976 CAGGGAAAACAATCCGAGAAAGG - Intergenic
919570458 1:199242487-199242509 AAGGGGAACCACGTTCAGAAAGG + Intergenic
920298308 1:204973429-204973451 AGGGGGAAACAGGCTGCGAAGGG - Intronic
920419210 1:205819105-205819127 AGGAGGAAACACTGTGACAAAGG + Intergenic
920709174 1:208278681-208278703 AAGGAGCACCTCTCTGAGAAAGG + Intergenic
920844802 1:209584705-209584727 ATGAGGAAAGCCTCTGAGAAGGG + Intronic
921729821 1:218565420-218565442 AAGGGGAAACAATCACACAAAGG + Intergenic
921747360 1:218753390-218753412 ATAGGGAAGCACTCTTAGAAGGG - Intergenic
923806519 1:237263929-237263951 AAGGGGAAAAAATAAGAGAAGGG + Intronic
923912075 1:238460120-238460142 AAAGGGACACGCTCGGAGAAGGG - Intergenic
924000012 1:239540144-239540166 ATGAGGACACATTCTGAGAAAGG - Intronic
924078740 1:240369929-240369951 AAGGGGAAACTCTCTCACATAGG - Intronic
1062953318 10:1522111-1522133 CAAGGGAAACATTCTGTGAATGG + Intronic
1063048819 10:2422651-2422673 AAGGGCAAACATTCTTGGAAGGG + Intergenic
1068640792 10:59404458-59404480 ATGGGGAAAGAATCAGAGAAGGG + Intergenic
1070418972 10:76217655-76217677 AAGGGGAAACGCGTTGGGAAAGG + Intronic
1071210570 10:83337307-83337329 TAGGGGAAGCTCTCTGAGATGGG - Intergenic
1071257174 10:83881238-83881260 AAGGGGACTCACTATGAGAAAGG - Intergenic
1071914248 10:90273222-90273244 AAAGGGAGACACTGTTAGAAAGG + Intergenic
1073538006 10:104295399-104295421 TAGGGCAACCCCTCTGAGAAGGG + Intronic
1075931861 10:126304127-126304149 ACGATGAAACACTCTAAGAAAGG + Intronic
1075961050 10:126567977-126567999 AAGGAGAAAACCTCTGGGAAAGG + Intronic
1077648074 11:3944220-3944242 CAGGGGAAACACCCTGTAAAAGG - Intronic
1078818656 11:14853079-14853101 AAGTGCAAACACTCTCAGAAAGG - Intronic
1079569096 11:21920921-21920943 AAGGAGAAAAATTTTGAGAAGGG - Intergenic
1080080337 11:28209784-28209806 AAGTGGAAACATTCAGAGCATGG + Intronic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1082522985 11:53996867-53996889 CACAGGAAACATTCTGAGAATGG - Intergenic
1083247260 11:61438685-61438707 AAGAAGAACCACTCTGGGAATGG + Intronic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1086999933 11:93407428-93407450 ATGGGGACACATTCTGAAAAAGG - Intronic
1087266457 11:96066880-96066902 AAGAGCAAAGACTCTGAGATGGG + Intronic
1087286723 11:96271964-96271986 AAGTGCAAACATTCTGAGACAGG - Intronic
1088706538 11:112469009-112469031 TAGGGGAGGCTCTCTGAGAAAGG - Intergenic
1089994118 11:122888676-122888698 AAGGGGAATGAGTTTGAGAAGGG - Intronic
1090316477 11:125794155-125794177 AATAGCAAACATTCTGAGAAAGG - Intergenic
1090473603 11:127000911-127000933 AAGAGGAAACACTCGGAAAAAGG + Intronic
1090521212 11:127481389-127481411 AACAGAAAACACTCAGAGAAAGG - Intergenic
1091095456 11:132817279-132817301 AAGATGATACACTCTGAAAAAGG + Intronic
1091143523 11:133257330-133257352 AAAGGGCAATACTCTGAGAAAGG + Intronic
1091226753 11:133961580-133961602 AAGGGAGAAAACTCTGAGATCGG - Intergenic
1091246211 11:134097150-134097172 GAGGGGAAACACCATGAGAGAGG + Intronic
1093269566 12:17042926-17042948 AAGAGACAACACTCTGAGACAGG + Intergenic
1093972515 12:25388059-25388081 ACAGGGAAACAAGCTGAGAAGGG - Intergenic
1097004195 12:55903250-55903272 GAGGGGCAACTATCTGAGAAAGG - Intronic
1097933332 12:65215199-65215221 AATGGGAAAGACCCTGAGCAAGG - Intronic
1101119715 12:101566205-101566227 AAAGGAAAACATTCTGGGAATGG - Intergenic
1101351536 12:103934252-103934274 AAGAGGAAACACTCTAGGACGGG + Exonic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1101610970 12:106291532-106291554 ATCAGGATACACTCTGAGAAAGG - Intronic
1101690812 12:107078917-107078939 AAGGGGAAAGGCTATGAGGAAGG - Intronic
1103419903 12:120771979-120772001 ATCAGGAAAGACTCTGAGAAAGG - Intronic
1104399157 12:128461456-128461478 AAAAGAAAACAGTCTGAGAAAGG + Intronic
1105266434 13:18822044-18822066 AAGGGAAAACAGTCTGAGATAGG - Intergenic
1106903910 13:34385042-34385064 GAGAGGAAACATTTTGAGAAAGG - Intergenic
1106904297 13:34388885-34388907 GAGAGGAAACATTTTGAGAAAGG - Intergenic
1107275221 13:38670550-38670572 TAGGGGTAATTCTCTGAGAAAGG + Intergenic
1111266557 13:85822730-85822752 AACAGGAAAAACTATGAGAAAGG - Intergenic
1111588616 13:90313720-90313742 AATGGGAGAAACACTGAGAAAGG + Intergenic
1112796291 13:103060000-103060022 AAATGCAAACACTCTGAGCAGGG - Intronic
1115925037 14:38423454-38423476 AAGGGGAAACACACACAAAAAGG - Intergenic
1116341754 14:43732031-43732053 AAGAGGTAACACTCAGAGAATGG + Intergenic
1116841872 14:49826971-49826993 AAGGGCAAAGACCCTGAGAGGGG + Intronic
1117907717 14:60608008-60608030 CAAGGGATACAATCTGAGAATGG - Intergenic
1118735198 14:68696102-68696124 AAGAGGAAACAGGCTGAGAGAGG - Intronic
1119351942 14:73973072-73973094 AAGGGGACACTCTCTGAGGCAGG + Intronic
1121372038 14:93368048-93368070 TAGCAGAATCACTCTGAGAAAGG - Intronic
1121554123 14:94823493-94823515 GAGGGCAAAAACTCAGAGAAAGG - Intergenic
1121664256 14:95660001-95660023 AATGGGAATCAGGCTGAGAAGGG - Intergenic
1121986393 14:98510544-98510566 AGGAAGAAAAACTCTGAGAAAGG + Intergenic
1122416660 14:101553043-101553065 TAGGGCAAACACCTTGAGAATGG - Intergenic
1202832092 14_GL000009v2_random:46037-46059 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1123688889 15:22820758-22820780 AAGGGGAGCCACTGTGGGAAGGG - Intronic
1124789323 15:32712637-32712659 CAGTGGAACCATTCTGAGAAGGG + Intergenic
1125518304 15:40335096-40335118 AAAGGGAATCACTCTGTTAAAGG - Exonic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1126939158 15:53746937-53746959 AAGTGGAAACAGTTTGGGAAAGG + Intronic
1127435743 15:58956543-58956565 AAGAGGAAAAACTCAGACAATGG - Intronic
1127678582 15:61270301-61270323 AAGAGTAATTACTCTGAGAAGGG - Intergenic
1128129850 15:65218987-65219009 AAAGGGAAACCCACTAAGAATGG - Intergenic
1128198596 15:65784034-65784056 AAGGGGAAATACTATCAGTACGG - Intronic
1128536117 15:68491878-68491900 AATGGGAAACACACTGACACTGG + Intergenic
1130600983 15:85273036-85273058 ATGGGGCAACACTTTGTGAATGG + Intergenic
1130858550 15:87864363-87864385 AAGGCTAAACTCTCAGAGAAGGG + Intronic
1131580505 15:93638318-93638340 AAGGTGACACATTCTGAGTATGG - Intergenic
1131783138 15:95881842-95881864 GAGAGGAAACACTGTCAGAAGGG - Intergenic
1132129107 15:99258328-99258350 AAGAGGAAACACTCTAGGACGGG + Intronic
1132616995 16:846341-846363 AATGAGAAACACTCCGTGAAAGG - Intergenic
1132926541 16:2432637-2432659 CAGGGGAAACACTCTAAAAGGGG - Intronic
1133975212 16:10595666-10595688 GAGGCGCAACACTCAGAGAAGGG + Intergenic
1134779559 16:16883483-16883505 AAGAGGAAACAAGCTCAGAAAGG + Intergenic
1136533664 16:30886688-30886710 AAGGGGAAACTCACTGAGCCTGG + Intronic
1137261810 16:46836749-46836771 ATGGGGAAATGTTCTGAGAAAGG - Intergenic
1137703651 16:50518178-50518200 AAGAAAAAACACTTTGAGAAAGG - Intergenic
1139238468 16:65365398-65365420 AAGAGCAAACACACTGAGTATGG + Intergenic
1139384226 16:66554064-66554086 AAGGGGGAACCATGTGAGAATGG + Intronic
1139986767 16:70905081-70905103 AAGCAGAAACACTCTGAAAAAGG + Intronic
1140981492 16:80113764-80113786 AAGTGTCAACACTCTGAGCAAGG + Intergenic
1142923093 17:3208223-3208245 AAGGAGAAACATTATCAGAAGGG - Intergenic
1143775868 17:9198400-9198422 AAGGGCAAACATTCAGAGAAGGG + Intronic
1143913218 17:10269301-10269323 AATTGTAAACACTGTGAGAAGGG - Intergenic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1146827174 17:36032892-36032914 GAGCTGAAACACTCTGAGCATGG - Intergenic
1147870381 17:43582947-43582969 AATGGGAAAGCCACTGAGAAGGG - Intergenic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148249101 17:46059246-46059268 AAGTGGAAAGTCTCTGAAAAGGG + Intronic
1151177622 17:72301771-72301793 AAGGGAAAACCCTCTAATAAAGG + Intergenic
1152990314 18:357785-357807 ATGGGGATACATTCTGAGAATGG + Intronic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1154421978 18:14239436-14239458 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1156360380 18:36379469-36379491 AAGAGTAAACACACTGATAATGG - Intronic
1156412552 18:36846605-36846627 AAGGGGAAACAGACTGTAAAAGG - Intronic
1156854866 18:41769724-41769746 AAGGAGCAACACACTGAAAACGG + Intergenic
1157741220 18:50095156-50095178 GAGGGGATACTCTGTGAGAAAGG - Intronic
1163953653 19:20613959-20613981 AAGGAGAAAGAGTGTGAGAAGGG + Intronic
1166867676 19:45850527-45850549 AAAGGGAAACAGGCTCAGAATGG - Intronic
1202640595 1_KI270706v1_random:81734-81756 AAGGGAAAACAGTCTGAGATAGG - Intergenic
925801869 2:7609654-7609676 GAGGGGAACCACTCTGAGGTGGG - Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
930266049 2:49200310-49200332 AAGAGGACACACTTGGAGAAGGG - Intergenic
930874079 2:56193752-56193774 AAGATGAAAGACTCTTAGAATGG - Intronic
931121833 2:59228299-59228321 CAATGGTAACACTCTGAGAAAGG + Intergenic
931400861 2:61930105-61930127 AAGGAGAAATTCTCTGAGAGGGG + Intronic
931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG + Intergenic
931838802 2:66127758-66127780 AAGGGAAAGCACTCAGGGAAGGG - Intergenic
932714035 2:74088663-74088685 AATGGGAAAAACTCTGATAAGGG - Intronic
933702131 2:85263159-85263181 ATAGTGAAACACTCAGAGAATGG + Intronic
934496158 2:94801697-94801719 AAGGGAAAGCAGTCTGAGATAGG - Intergenic
937783070 2:125861502-125861524 AAGGGGAAACATTTTGGAAATGG + Intergenic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
939250025 2:139671289-139671311 TAGGGGAGACCCTCTGAGACGGG - Intergenic
939307254 2:140427339-140427361 AAGGGTAAAGACACGGAGAAGGG - Intronic
939714834 2:145570947-145570969 AAGGAAACACACTCTCAGAAGGG - Intergenic
939719964 2:145636187-145636209 ATGAGGACACATTCTGAGAAAGG - Intergenic
940486000 2:154296055-154296077 AAGGAGGCACACTTTGAGAAAGG - Intronic
941837522 2:170041361-170041383 ATGGGAAAACATTCTGAAAATGG + Intronic
942049438 2:172125266-172125288 AAGAGAATACATTCTGAGAAAGG - Intergenic
942641651 2:178066974-178066996 AAGGGGAAAGATTCTAAGTAGGG - Intronic
942675924 2:178426880-178426902 AAGTGAAAAAACTCTGAGCATGG - Intergenic
942819207 2:180091268-180091290 ATGGGGATACATTCTGAGAAAGG - Intergenic
942867024 2:180689049-180689071 AAGGGGAAACACACTCTGAAAGG - Intergenic
944305196 2:198171026-198171048 AATGGAAGACAGTCTGAGAAAGG - Intronic
944325870 2:198402927-198402949 AACAGGAAACACTTTGAGTATGG - Intronic
945128276 2:206537520-206537542 GTGGGGAAACACTCAGAAAAGGG - Intronic
946565946 2:220966098-220966120 AAGGGGAGAAACACTGAGAGAGG + Intergenic
947601253 2:231451922-231451944 ACGGGGTAACTCTCAGAGAAAGG + Intergenic
947993771 2:234509806-234509828 AAGCAGAGACCCTCTGAGAAGGG - Intergenic
948589209 2:239038684-239038706 AAGAGGAGACACACGGAGAAGGG - Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169484020 20:6011535-6011557 AAGGAGAAAGATTGTGAGAATGG - Intronic
1169859655 20:10137862-10137884 AAGGGGCAAAACTAAGAGAATGG + Intergenic
1170529761 20:17279143-17279165 ATGCGGAAATAATCTGAGAAAGG - Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171887478 20:30668460-30668482 AAGGGAAAACAGTCTGATATAGG - Intergenic
1173261305 20:41438758-41438780 CAGGGAAAACACTCTCTGAATGG - Intronic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1174351051 20:49968400-49968422 AAGGAGAGAGTCTCTGAGAAGGG + Intergenic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176851504 21:13920524-13920546 AAGGGAAAACAGTCTGAGATAGG - Intergenic
1178602045 21:34003000-34003022 AAGGGGAATCACTCGGGGATGGG - Intergenic
1178739023 21:35179340-35179362 TGGAGGAAACACTCAGAGAAGGG + Intronic
1178926060 21:36776005-36776027 AAGAGGACACAGTCTCAGAAAGG + Intronic
1179274533 21:39879933-39879955 AAGGGGGACCACTCTCAGAAGGG - Intronic
1179533248 21:42034341-42034363 AAGGGGAAAAAAGCAGAGAAGGG - Intergenic
1180361348 22:11900148-11900170 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1180752096 22:18131480-18131502 GAGTGGGAACACTCAGAGAAAGG + Exonic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182950797 22:34373856-34373878 AAGGAAAAACACTCAGAGCATGG + Intergenic
1184558902 22:45249977-45249999 CAGGGGAAACATTTTGATAAGGG + Intergenic
1185062148 22:48612638-48612660 AAAGGGAGACACTCCGGGAAAGG - Intronic
1185065237 22:48628732-48628754 AAGGAGAAACACCCTACGAAGGG - Intronic
949126345 3:449499-449521 ATGGGGATTCATTCTGAGAAAGG + Intergenic
950584381 3:13881887-13881909 AAGGGAACACACTGTGGGAATGG + Intergenic
951328913 3:21341993-21342015 AAGGGCAATCTCTCTGAGGAAGG + Intergenic
952468138 3:33613393-33613415 AAGGGGCAACACCTTGGGAAAGG + Intronic
952586204 3:34895457-34895479 AAAGGGAAATAATCAGAGAATGG + Intergenic
952605097 3:35137239-35137261 AAGGAGAAATACTCTGATATGGG + Intergenic
955208328 3:56917638-56917660 ATGGGGACAAAGTCTGAGAAGGG + Intronic
956573225 3:70720314-70720336 AAAGGGCTACACACTGAGAAAGG - Intergenic
958054197 3:88388020-88388042 TTGGGGAAACACTATGGGAAAGG - Intergenic
958721009 3:97843443-97843465 GTGGGGAAAGGCTCTGAGAAGGG + Intronic
959860567 3:111210656-111210678 AAGGGGAAACAGTTTTAGATTGG + Intronic
961115698 3:124327923-124327945 AAGAGGAAACAAGCTCAGAATGG - Intronic
961683242 3:128612839-128612861 AAGGGGAGAGTCTGTGAGAAAGG + Intergenic
961985136 3:131124006-131124028 AAAGCCAAACACACTGAGAATGG - Intronic
962884108 3:139607708-139607730 AAAGAGGAACACTCAGAGAAGGG + Intronic
962961127 3:140312038-140312060 AAGGGAAAGCACTCTGAGTCTGG - Intronic
963060563 3:141221533-141221555 AAGGGGAATGAGACTGAGAAGGG + Intergenic
964304190 3:155324005-155324027 AAGGGGAATTACCCTGGGAATGG - Intergenic
964497342 3:157305612-157305634 AAGTGGAATCACTGTGTGAAAGG + Intronic
965958378 3:174399030-174399052 AAGGGGAAAGAATCAGCGAAAGG - Intergenic
966053125 3:175646795-175646817 AAGGGGAAACTATATAAGAAAGG - Intronic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
1202737960 3_GL000221v1_random:25672-25694 AAGGGAAAACAGTCTGAGATAGG + Intergenic
969060085 4:4427239-4427261 AAGGGGCAAAGCTCTGGGAAGGG + Intronic
969163990 4:5289019-5289041 ACAGGGATACATTCTGAGAAAGG + Intronic
969644125 4:8416663-8416685 AAAGAGAATCACTCTGTGAATGG + Intronic
970060496 4:12027678-12027700 AATGGCAATCACACTGAGAAAGG - Intergenic
970974208 4:22024250-22024272 AAGGGTAATCAGTCAGAGAAAGG + Intergenic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
971571971 4:28224248-28224270 AAGAGGAAACATTCTAAGTAGGG - Intergenic
971672340 4:29578803-29578825 AAAGGGAAACACTGTCTGAATGG - Intergenic
971861447 4:32110954-32110976 AAGAGCAAAGACCCTGAGAAAGG + Intergenic
972191934 4:36603741-36603763 AAGGGGACAGACACAGAGAATGG - Intergenic
972576150 4:40353884-40353906 ACAGGGATACATTCTGAGAAAGG - Intronic
973384106 4:49492248-49492270 AAGGGAAAACAGTCTGAGATAGG - Intergenic
973731080 4:53822829-53822851 AAGGGCAGACATTCTGAGCATGG + Intronic
974270326 4:59642542-59642564 ATGGTGAAACATTCTGAAAAAGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978144546 4:105356332-105356354 AACTGGAAACACTCTAAGGATGG - Intergenic
978171793 4:105680183-105680205 AAGGGAAAACACTAAAAGAAAGG - Exonic
979145828 4:117246608-117246630 AAGGAGAAACGCTCTGTGAAAGG + Intergenic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
980298630 4:130957903-130957925 AAGGGTTAATACTCTGGGAAAGG - Intergenic
980955475 4:139424228-139424250 GATGGGATACATTCTGAGAAAGG + Intergenic
982702339 4:158671416-158671438 AAGGGGGAACCCTCAGAGAGGGG + Intronic
983535577 4:168853646-168853668 AAGGGCTGAGACTCTGAGAATGG + Intronic
984276914 4:177622166-177622188 ATGGGGATACATTCTGAGTACGG - Intergenic
1202767961 4_GL000008v2_random:167573-167595 AAGGGAAAACAGTCTGAGATAGG - Intergenic
988952193 5:36274493-36274515 AAGAGGAAAGTCTCTGAGGAAGG + Intronic
990517649 5:56545142-56545164 AAGGGGAAGCATTCTGAAATAGG - Intronic
990556302 5:56939965-56939987 AAGGGAATACATTCTGAAAAAGG - Intronic
991520823 5:67494946-67494968 AAGTGGAAACAGGCTGGGAAAGG + Intergenic
994132223 5:96243124-96243146 AATGGGAAGTACTTTGAGAAGGG - Intergenic
995637129 5:114206336-114206358 AAATGGAAACACTCTGAGATGGG - Intergenic
995658920 5:114459353-114459375 AAGGAGAACTATTCTGAGAAAGG - Intronic
997147220 5:131448933-131448955 CATGGGAAACACACAGAGAAGGG + Intronic
998034378 5:138901699-138901721 AATGAGAAACACTCTGAGCTGGG - Intronic
998191849 5:140031964-140031986 AAGGAGAAACATTAGGAGAAAGG + Intronic
998784687 5:145696239-145696261 GAGGTGAAATACTTTGAGAAGGG - Intronic
999931126 5:156433832-156433854 AAGGGGAGACACTTTGGGAAAGG - Intronic
1000235557 5:159356386-159356408 AAGGGCAAAGGCTCTGAGACAGG - Intergenic
1000697211 5:164402243-164402265 AAGGGGAAAAACTTTCAGATAGG - Intergenic
1002602813 5:180363704-180363726 AAGTGGAGAGACTCTGAGAGTGG + Intergenic
1002691657 5:181054185-181054207 AAGGGGAAAGACTCTCAGGTTGG - Intronic
1002971898 6:2031538-2031560 ATGGGGATACAATCTGAGATAGG + Intronic
1003700862 6:8463222-8463244 AAGGGGAAACACTACTAGTAGGG - Intergenic
1004201395 6:13551620-13551642 AAGAGGAAACACATTGAGAGAGG + Intergenic
1004734713 6:18393794-18393816 AAGGGGAAAGTTTTTGAGAAGGG - Intronic
1006512352 6:34528554-34528576 AAAGGGAAAGCCTCAGAGAAGGG + Intronic
1008318147 6:50072325-50072347 AAGGGGAAACCCTCCGAGTCAGG + Intergenic
1008486486 6:52041646-52041668 AAGATGGAAAACTCTGAGAAGGG - Intronic
1008493713 6:52111873-52111895 AAGTGCAAAGACCCTGAGAAAGG + Intergenic
1009421644 6:63470847-63470869 AAGAGAAAATTCTCTGAGAAGGG + Intergenic
1011564919 6:88664170-88664192 ATAGGGAAGCACTCTTAGAAGGG + Intronic
1011914244 6:92483265-92483287 AATGGGGAACAATCTGAAAAAGG - Intergenic
1012973256 6:105753874-105753896 AAAGGGAAATACTGTGAGACGGG + Intergenic
1014829603 6:126086871-126086893 TGGGGGCACCACTCTGAGAAGGG + Intergenic
1014963917 6:127722679-127722701 AACGGACAACACTCAGAGAAGGG - Intronic
1014995862 6:128143586-128143608 AAGGGCAATAACTCTGTGAAAGG - Intronic
1015378852 6:132543959-132543981 AAAGGGAACCCCTCTGAGAATGG - Intergenic
1016267057 6:142244996-142245018 AAGGGAAAACACACTGAAAAAGG - Intergenic
1018610960 6:165647388-165647410 AAGGCGAAACGCTCAGAGACAGG + Intronic
1018739384 6:166715562-166715584 ACGGGGATACGTTCTGAGAAAGG + Intronic
1019653007 7:2170790-2170812 AAGGCGACACAGGCTGAGAAGGG + Intronic
1021031950 7:15748150-15748172 AAGGTGGGACACTCTGGGAAGGG + Intergenic
1021035333 7:15791195-15791217 AACACCAAACACTCTGAGAAAGG + Intergenic
1021633313 7:22667227-22667249 AAGAGAAAACATTCTGGGAAGGG - Intergenic
1021708663 7:23393535-23393557 AAAGGGAAACAGGCTGAGAGGGG + Intronic
1021863977 7:24936538-24936560 AAGCAGAATGACTCTGAGAAAGG + Intronic
1022276057 7:28856073-28856095 AAGGGGTGACACACTGATAATGG + Intergenic
1022321675 7:29293743-29293765 AGGGGGAAACAGTGTGGGAAAGG - Intronic
1026816760 7:73519425-73519447 AAGTGGAAGCACTTTGAGGATGG - Intronic
1027046101 7:74992273-74992295 AAGGGGAAAGACTTTTAGCATGG - Intronic
1027209914 7:76137555-76137577 AAGAGGTAACACACTGGGAAGGG + Intergenic
1027666709 7:81049162-81049184 AATGGGCAACTGTCTGAGAAGGG + Intergenic
1027671564 7:81105719-81105741 AAGAGGAAACATTATGAGTAAGG + Intergenic
1029259723 7:99293583-99293605 CAGGAGAGACTCTCTGAGAAGGG - Intergenic
1033068341 7:138177575-138177597 AAAGAGCAAGACTCTGAGAAAGG + Intergenic
1033084555 7:138330200-138330222 AAGGGTAGAGACACTGAGAAGGG - Intergenic
1033191577 7:139285524-139285546 AATGAGAAAGAGTCTGAGAATGG - Intronic
1033398496 7:140998918-140998940 AATGGGGTACAATCTGAGAACGG + Intergenic
1034573880 7:151980688-151980710 AAGGGGAAAAACAGTGGGAAAGG - Intronic
1035417745 7:158704400-158704422 GAGGGGACACTCTCTGAGGACGG + Intronic
1037017916 8:13931540-13931562 ATGTGGAAAAAATCTGAGAAAGG - Intergenic
1038038334 8:23704712-23704734 AAGAGGAAAAATTCTGAGGAGGG + Intronic
1038975925 8:32696020-32696042 ACTGGCAAACACTCTGGGAAGGG - Intronic
1039290570 8:36089932-36089954 AAGTGGAAAGGCTCTGAGATAGG - Intergenic
1039417942 8:37411659-37411681 AAGAGGGAACACTCTGGGCACGG + Intergenic
1042701296 8:71618036-71618058 AAGGGATAAAACTTTGAGAAAGG - Intergenic
1043150259 8:76706078-76706100 AAGGAGAAACACCCTGAGCCGGG + Exonic
1043233033 8:77826274-77826296 AAGGGGACCCAGTCTCAGAAAGG - Intergenic
1043239958 8:77920232-77920254 AAGGAAAAATATTCTGAGAATGG - Intergenic
1044268815 8:90215609-90215631 AAGGAGAAACTCCCTCAGAATGG - Intergenic
1044495329 8:92871520-92871542 AAGTGGAAAAACTCTGGGTATGG + Intergenic
1045052501 8:98339969-98339991 AAGTGGAAACCCTCTGAACAAGG + Intergenic
1046719023 8:117597946-117597968 AGGGGGAAACAGGCTGAAAAAGG - Intergenic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1047638778 8:126796044-126796066 AAAGGGAAGCAATCTGAAAAGGG + Intergenic
1047906875 8:129481837-129481859 ATGGGAAAACACTCTCAGAGAGG - Intergenic
1047984785 8:130221351-130221373 TAGGGGAAACACTTTCACAAAGG - Intronic
1048682210 8:136855753-136855775 AAGTGGAAAGACTCAGAGTATGG + Intergenic
1050682316 9:8126449-8126471 AAGGAGAAAGACAGTGAGAAAGG - Intergenic
1051668339 9:19486149-19486171 AAGAGCATACGCTCTGAGAACGG - Intergenic
1051938205 9:22470388-22470410 ATGAGTAAACAATCTGAGAAAGG + Intergenic
1052615943 9:30842243-30842265 CAAGGAAGACACTCTGAGAAAGG - Intergenic
1052684467 9:31737324-31737346 AATGGAAAACAGTCTTAGAAAGG - Intergenic
1052875924 9:33563518-33563540 AAGGGAAAGCAGTCTGAGATAGG + Intronic
1053500085 9:38580843-38580865 AAGGGAAAGCAGTCTGAGATAGG - Intergenic
1053660981 9:40278682-40278704 AAGGGAAAGCAGTCTGAGATAGG + Intronic
1053911358 9:42908019-42908041 AAGGGAAAGCAGTCTGAGATAGG + Intergenic
1054361979 9:64131645-64131667 AAGGGAAAACAGTCTGAAATAGG + Intergenic
1054373102 9:64424896-64424918 AAGGGAAAGCAGTCTGAGATAGG + Intergenic
1054523629 9:66097602-66097624 AAGGGAAAGCAGTCTGAGATAGG - Intergenic
1054680733 9:67914675-67914697 AAGGGAAAGCAGTCTGAGATAGG + Intergenic
1055433958 9:76273435-76273457 AAGAAGAAACACCTTGAGAAGGG - Intronic
1055705181 9:78991593-78991615 AAAGGGAAACAAACTGATAAAGG + Intergenic
1056142242 9:83694015-83694037 AACTGTAAACACTCTGAAAATGG + Intronic
1056931328 9:90880418-90880440 GAGGTGAACCACTGTGAGAAAGG + Intronic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058700196 9:107593839-107593861 CAGGAGAAAGTCTCTGAGAATGG + Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059467391 9:114477652-114477674 CAGGGGAAGGACACTGAGAACGG + Intronic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1060216494 9:121741563-121741585 AAGGTGAGAAACACTGAGAAAGG - Intronic
1062282738 9:135759252-135759274 AAGGGGCAAGGCTCTGAGATGGG + Intronic
1203692373 Un_GL000214v1:56499-56521 AAGGGAAAACAGTCTGAGATAGG - Intergenic
1203706688 Un_KI270742v1:56116-56138 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1203556557 Un_KI270744v1:3391-3413 AAGGGAAAACAGTCTGAGATAGG - Intergenic
1203643922 Un_KI270751v1:47692-47714 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1186162687 X:6794159-6794181 ATGGGGACACACTCTGAGAAAGG + Intergenic
1187008445 X:15254851-15254873 GAGGGGAAACAGTCAGAGTAAGG + Intronic
1187319590 X:18227755-18227777 AAGGGGAGACAGGCTGAGCATGG + Intergenic
1187705740 X:22007641-22007663 CAGAGGTGACACTCTGAGAAGGG + Intergenic
1188412635 X:29892716-29892738 AATGGGAAACAATGTGAGGATGG + Intronic
1188680746 X:33001098-33001120 AGGGGGAAACACCCTGATATAGG + Intronic
1190437178 X:50437232-50437254 GAGGTGAAACACTGTGAAAAAGG - Intronic
1190850074 X:54231563-54231585 AAAGGGAAACAGTGTCAGAAAGG - Intronic
1191607224 X:63076073-63076095 ACGGGGAAACACTATGGTAATGG + Intergenic
1192064005 X:67862037-67862059 ATGAGGAAACACACTGAAAACGG - Intergenic
1192226899 X:69235175-69235197 AAGTGGAAACACTCTCAGAAAGG + Intergenic
1193202845 X:78712598-78712620 GAAGGGAAACATTCTGATAATGG - Intergenic
1194205249 X:91003477-91003499 AGTGGGAAACAGTCTAAGAATGG + Intergenic
1195630059 X:107046114-107046136 ACAGGGACACATTCTGAGAATGG + Intergenic
1196201033 X:112886218-112886240 AATGGCAAACTCTCTAAGAATGG + Intergenic
1196305981 X:114103854-114103876 AAGGGGAGACACTTTCATAAGGG - Intergenic
1196939193 X:120759246-120759268 CAGGGCAATCACTCTGTGAATGG - Intergenic
1197789044 X:130232432-130232454 TAGGAGAAACTATCTGAGAAAGG + Intronic
1197858731 X:130947302-130947324 AAGGGGAAAAAATCTTAGCAGGG + Intergenic
1198756434 X:139987179-139987201 CAGAAGAAACACTCTGAAAATGG + Intergenic
1200551065 Y:4578621-4578643 AGTGGGAAACAGTCTAAGAATGG + Intergenic
1201613773 Y:15872844-15872866 AGAGGGATACATTCTGAGAAAGG - Intergenic