ID: 1057800082

View in Genome Browser
Species Human (GRCh38)
Location 9:98185650-98185672
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057800082_1057800085 -10 Left 1057800082 9:98185650-98185672 CCAACACCGTGGTGCAGCCTTAG No data
Right 1057800085 9:98185663-98185685 GCAGCCTTAGGAACAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057800082 Original CRISPR CTAAGGCTGCACCACGGTGT TGG (reversed) Intronic