ID: 1057800082

View in Genome Browser
Species Human (GRCh38)
Location 9:98185650-98185672
Sequence CTAAGGCTGCACCACGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057800082_1057800085 -10 Left 1057800082 9:98185650-98185672 CCAACACCGTGGTGCAGCCTTAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1057800085 9:98185663-98185685 GCAGCCTTAGGAACAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057800082 Original CRISPR CTAAGGCTGCACCACGGTGT TGG (reversed) Intronic
900393802 1:2444924-2444946 CTGAGGCTGCACCTCGCTGAAGG - Intronic
903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG + Exonic
904619823 1:31768485-31768507 CTGTGGCTGCAGCATGGTGTGGG - Intergenic
904870656 1:33615800-33615822 CTGTGGTTTCACCACGGTGTAGG - Intronic
907544732 1:55249857-55249879 GTAAGGCTGCACCACAGCGGGGG + Intergenic
908009165 1:59758155-59758177 CTAAGGCTGCAGAACTATGTAGG + Intronic
917133286 1:171763756-171763778 TTCAGGCTACACCAAGGTGTGGG + Intergenic
918435735 1:184510907-184510929 GTAAGTCTGAACCAAGGTGTTGG + Intronic
1067526695 10:47043525-47043547 TCAAGGCTCCACCACTGTGTGGG + Intergenic
1076798123 10:132808627-132808649 CTGAGGCTGCACCAAGGGCTGGG + Exonic
1080194063 11:29587206-29587228 ATTAGGCTGCATCAAGGTGTTGG - Intergenic
1103450838 12:121027682-121027704 CGAAGGCTTCACCACTGTGATGG - Exonic
1108430817 13:50351965-50351987 CTTAGGCTGCACAATGGTCTAGG - Intronic
1118968833 14:70614072-70614094 CTAAGGCTACACCCCTGTCTAGG - Intergenic
1122626231 14:103086731-103086753 CTAAGGCTGCGACCCTGTGTAGG - Intergenic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1128649148 15:69397857-69397879 CCAAGGCAGCACCTGGGTGTGGG - Intronic
1131196645 15:90360682-90360704 GTAAGGCTTCACCCCTGTGTGGG - Exonic
1132536252 16:482604-482626 CTCAGGGTGCACCAGGGTGCTGG - Exonic
1135576544 16:23590322-23590344 CTATGCCTGCACCATGGTGCTGG + Intronic
1139542449 16:67628398-67628420 GTAAGGCTTCTCCCCGGTGTGGG - Exonic
1140833002 16:78768901-78768923 CTGACGCTGCGCCATGGTGTAGG + Intronic
1148892317 17:50817184-50817206 TCAAGCCTTCACCACGGTGTGGG - Intergenic
1152171740 17:78755081-78755103 GTATGGCTGCACCACGTTTTTGG - Intronic
1152439234 17:80295289-80295311 CCCAGGCTGCACCGCAGTGTGGG - Intronic
1158156420 18:54430619-54430641 TGAAGGCTGCTCCACGGTGAAGG + Intergenic
1168118368 19:54238909-54238931 CTGAGGCTCCACCACGCTGAAGG + Exonic
1168170801 19:54587368-54587390 CTGAGGCTCCACCACGCTGAAGG - Exonic
1168252109 19:55147151-55147173 CTTAGGCCGCACCAGGATGTCGG - Exonic
931444317 2:62314072-62314094 CTGAGGTTTCACCAGGGTGTAGG + Intergenic
934606555 2:95699590-95699612 CATAGGATGCACCAGGGTGTTGG - Intergenic
934661810 2:96147055-96147077 CTAAGGCTACTCCACTGTCTGGG + Intergenic
943992491 2:194714543-194714565 ACAAGGCTGCATCAAGGTGTTGG - Intergenic
948242129 2:236446687-236446709 TTAGGGCTGCCACACGGTGTGGG + Intronic
948694307 2:239725520-239725542 CTGAAGCTGCACCAGGGTGGAGG - Intergenic
1170539651 20:17374978-17375000 CTAAGGCTGCATCATGAGGTAGG - Intronic
1174257746 20:49270837-49270859 CTCAGGCTGCACTAGAGTGTAGG + Exonic
1174541092 20:51290047-51290069 CTAATGATGCACCCCGGTGTGGG - Intergenic
1177693691 21:24543571-24543593 GTCAGGCTGCACCACGTAGTGGG - Intergenic
952348489 3:32511261-32511283 CAAAGGCTTGACCACAGTGTTGG - Intergenic
955857086 3:63284371-63284393 CTAGGGCTGCAGCATTGTGTTGG - Intronic
958034153 3:88150153-88150175 CTGAGGCTGCACCAGGCGGTTGG - Exonic
968525000 4:1052231-1052253 CTGAGGCTGCACAGCGGTGGGGG + Intergenic
968565120 4:1308120-1308142 CACAGGCTGTACCACGGTGCGGG - Intronic
973807177 4:54537846-54537868 CTGGGGCTGCCCCAGGGTGTGGG + Intergenic
978735289 4:112077603-112077625 GTAGGGCTCCACCACTGTGTCGG - Intergenic
981625078 4:146746285-146746307 CTAGGGCTACAACACTGTGTAGG + Intronic
988306261 5:29498482-29498504 CTACAGCTGCAGCAAGGTGTTGG + Intergenic
990024981 5:51176526-51176548 CTCAGGAGGCACCACTGTGTTGG - Intergenic
996665066 5:126049646-126049668 CCAAGGCTCCACCCCAGTGTGGG - Intergenic
997642767 5:135460342-135460364 CGATGGCTGCTCCACAGTGTCGG + Intergenic
997653790 5:135540588-135540610 CTCAGGGTGCAGCAAGGTGTTGG + Intergenic
998457073 5:142281499-142281521 CTTTGGCTGCACCATGTTGTGGG + Intergenic
1000891920 5:166810929-166810951 CTAAGGCTGTGCCACTCTGTAGG + Intergenic
1004337491 6:14777455-14777477 TTAAGTCTGTACCACTGTGTCGG - Intergenic
1014537590 6:122634014-122634036 CAAAGGATGCACTACTGTGTAGG - Intronic
1019797958 7:3065917-3065939 CTAGGGCTGCACCACGATGGTGG - Intergenic
1025910337 7:65823736-65823758 CTCAGGCTGCAGCACAGTGACGG + Intergenic
1028946776 7:96589082-96589104 TGAAGGCTGCACCCAGGTGTGGG + Intronic
1039583459 8:38685738-38685760 CTAAGATGGCACCAGGGTGTAGG + Intergenic
1049853688 8:144848680-144848702 CTAAGTCTGCTCCACGCTGTAGG + Intronic
1057794128 9:98143517-98143539 CCAAGGCTGCACCATGGTAAGGG - Intronic
1057800082 9:98185650-98185672 CTAAGGCTGCACCACGGTGTTGG - Intronic
1061820345 9:133223925-133223947 CTGAGGCTGCACACCGGGGTAGG + Intergenic
1061888404 9:133605032-133605054 CCAAGGCTGCCCCACGATGTGGG + Intergenic
1061920447 9:133779696-133779718 ATAAGGCAGCACCAGGCTGTAGG - Intronic
1186067280 X:5779346-5779368 CTAAGTCTACACCTGGGTGTTGG + Intergenic
1191923246 X:66279495-66279517 CTAAGGCTGCACTCAGGAGTAGG + Intergenic
1197392353 X:125883384-125883406 CTGAGGCTGCACAAGGGAGTGGG - Intergenic