ID: 1057800085

View in Genome Browser
Species Human (GRCh38)
Location 9:98185663-98185685
Sequence GCAGCCTTAGGAACAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057800078_1057800085 1 Left 1057800078 9:98185639-98185661 CCCAGCCTGGGCCAACACCGTGG No data
Right 1057800085 9:98185663-98185685 GCAGCCTTAGGAACAGCCACAGG No data
1057800081_1057800085 -4 Left 1057800081 9:98185644-98185666 CCTGGGCCAACACCGTGGTGCAG No data
Right 1057800085 9:98185663-98185685 GCAGCCTTAGGAACAGCCACAGG No data
1057800080_1057800085 0 Left 1057800080 9:98185640-98185662 CCAGCCTGGGCCAACACCGTGGT No data
Right 1057800085 9:98185663-98185685 GCAGCCTTAGGAACAGCCACAGG No data
1057800077_1057800085 2 Left 1057800077 9:98185638-98185660 CCCCAGCCTGGGCCAACACCGTG No data
Right 1057800085 9:98185663-98185685 GCAGCCTTAGGAACAGCCACAGG No data
1057800082_1057800085 -10 Left 1057800082 9:98185650-98185672 CCAACACCGTGGTGCAGCCTTAG No data
Right 1057800085 9:98185663-98185685 GCAGCCTTAGGAACAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057800085 Original CRISPR GCAGCCTTAGGAACAGCCAC AGG Intronic