ID: 1057801904

View in Genome Browser
Species Human (GRCh38)
Location 9:98195915-98195937
Sequence CCCTTCCCTGCTCTTTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057801904_1057801916 24 Left 1057801904 9:98195915-98195937 CCTCCAGAAAGAGCAGGGAAGGG No data
Right 1057801916 9:98195962-98195984 ACAGCAGGCACAGATGCTCTGGG No data
1057801904_1057801917 25 Left 1057801904 9:98195915-98195937 CCTCCAGAAAGAGCAGGGAAGGG No data
Right 1057801917 9:98195963-98195985 CAGCAGGCACAGATGCTCTGGGG No data
1057801904_1057801919 29 Left 1057801904 9:98195915-98195937 CCTCCAGAAAGAGCAGGGAAGGG No data
Right 1057801919 9:98195967-98195989 AGGCACAGATGCTCTGGGGTGGG No data
1057801904_1057801910 -4 Left 1057801904 9:98195915-98195937 CCTCCAGAAAGAGCAGGGAAGGG No data
Right 1057801910 9:98195934-98195956 AGGGCAAGCAGGCGCCCCAGGGG No data
1057801904_1057801908 -6 Left 1057801904 9:98195915-98195937 CCTCCAGAAAGAGCAGGGAAGGG No data
Right 1057801908 9:98195932-98195954 GAAGGGCAAGCAGGCGCCCCAGG No data
1057801904_1057801915 23 Left 1057801904 9:98195915-98195937 CCTCCAGAAAGAGCAGGGAAGGG No data
Right 1057801915 9:98195961-98195983 AACAGCAGGCACAGATGCTCTGG No data
1057801904_1057801909 -5 Left 1057801904 9:98195915-98195937 CCTCCAGAAAGAGCAGGGAAGGG No data
Right 1057801909 9:98195933-98195955 AAGGGCAAGCAGGCGCCCCAGGG No data
1057801904_1057801918 28 Left 1057801904 9:98195915-98195937 CCTCCAGAAAGAGCAGGGAAGGG No data
Right 1057801918 9:98195966-98195988 CAGGCACAGATGCTCTGGGGTGG No data
1057801904_1057801911 9 Left 1057801904 9:98195915-98195937 CCTCCAGAAAGAGCAGGGAAGGG No data
Right 1057801911 9:98195947-98195969 GCCCCAGGGGCAGCAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057801904 Original CRISPR CCCTTCCCTGCTCTTTCTGG AGG (reversed) Intergenic
No off target data available for this crispr