ID: 1057802856

View in Genome Browser
Species Human (GRCh38)
Location 9:98200496-98200518
Sequence TCCCCACACATTGTGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 496}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057802856_1057802863 -4 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802863 9:98200515-98200537 GGGATAGGCTCCAGGGGGCTGGG 0: 1
1: 0
2: 0
3: 35
4: 233
1057802856_1057802869 18 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802869 9:98200537-98200559 GGGAGACTGAATACCCCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 60
1057802856_1057802873 26 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802873 9:98200545-98200567 GAATACCCCGGCGGGGTGGTGGG No data
1057802856_1057802872 25 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802872 9:98200544-98200566 TGAATACCCCGGCGGGGTGGTGG No data
1057802856_1057802864 -3 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802864 9:98200516-98200538 GGATAGGCTCCAGGGGGCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 318
1057802856_1057802877 30 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802877 9:98200549-98200571 ACCCCGGCGGGGTGGTGGGGGGG No data
1057802856_1057802868 17 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802868 9:98200536-98200558 GGGGAGACTGAATACCCCGGCGG 0: 1
1: 0
2: 2
3: 5
4: 84
1057802856_1057802860 -10 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802860 9:98200509-98200531 TGTGTGGGGATAGGCTCCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 265
1057802856_1057802862 -5 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802862 9:98200514-98200536 GGGGATAGGCTCCAGGGGGCTGG 0: 1
1: 0
2: 3
3: 20
4: 364
1057802856_1057802874 27 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802874 9:98200546-98200568 AATACCCCGGCGGGGTGGTGGGG No data
1057802856_1057802871 22 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802871 9:98200541-98200563 GACTGAATACCCCGGCGGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 53
1057802856_1057802861 -9 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802861 9:98200510-98200532 GTGTGGGGATAGGCTCCAGGGGG 0: 1
1: 0
2: 4
3: 27
4: 207
1057802856_1057802865 -2 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802865 9:98200517-98200539 GATAGGCTCCAGGGGGCTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 232
1057802856_1057802870 19 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802870 9:98200538-98200560 GGAGACTGAATACCCCGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 37
1057802856_1057802876 29 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802876 9:98200548-98200570 TACCCCGGCGGGGTGGTGGGGGG No data
1057802856_1057802875 28 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802875 9:98200547-98200569 ATACCCCGGCGGGGTGGTGGGGG No data
1057802856_1057802867 14 Left 1057802856 9:98200496-98200518 CCTGGAGGCACAATGTGTGGGGA 0: 1
1: 0
2: 1
3: 25
4: 496
Right 1057802867 9:98200533-98200555 CTGGGGGAGACTGAATACCCCGG 0: 1
1: 0
2: 1
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057802856 Original CRISPR TCCCCACACATTGTGCCTCC AGG (reversed) Intronic
901477472 1:9500492-9500514 TCACCACAACTTCTGCCTCCTGG + Intergenic
901767369 1:11511732-11511754 TCCCCACACAGAGTCCCTACTGG - Intronic
901948612 1:12723856-12723878 TCACCACAACTTCTGCCTCCTGG + Intronic
904410748 1:30323394-30323416 TACCCAAACCTTGTGCCTCAAGG - Intergenic
904726413 1:32551632-32551654 TCACCACAAACTCTGCCTCCCGG - Intronic
905335382 1:37241104-37241126 TCCCCCCACATTCTGCCCGCAGG - Intergenic
906645489 1:47471493-47471515 TGCCCACACCTTGTGCCTTTTGG - Intergenic
907425586 1:54377262-54377284 TCCCCACAAGGTCTGCCTCCAGG + Intronic
907439275 1:54468863-54468885 TCCCCACACAGTGTCCCTACTGG + Intergenic
907864538 1:58386983-58387005 TCACCACAACTTCTGCCTCCCGG - Intronic
907978758 1:59460105-59460127 CCCCCACCCCTTGTGCTTCCCGG - Intronic
909912427 1:81277595-81277617 TCACCAGACACTGTGCCTGCTGG - Intergenic
910001739 1:82350116-82350138 CCCCCACACAGGGTCCCTCCTGG - Intergenic
910131570 1:83913906-83913928 GCCAGAAACATTGTGCCTCCAGG + Intronic
911012966 1:93300819-93300841 TCACCACAACTTCTGCCTCCTGG - Intergenic
911030633 1:93484001-93484023 TCACCACAACTTCTGCCTCCTGG + Intronic
911242137 1:95478486-95478508 CCCCCACACACAGTGCCTACTGG + Intergenic
911405993 1:97440187-97440209 TCACCACAACTTTTGCCTCCCGG - Intronic
911985456 1:104616665-104616687 TCCCCACACAGAGTCCCTACTGG - Intergenic
912046316 1:105463281-105463303 TCACCACAAACTCTGCCTCCTGG + Intergenic
912267293 1:108171508-108171530 TCCCCATATATGCTGCCTCCAGG + Intronic
912459228 1:109820031-109820053 TCCCCAAGCATTGCGGCTCCGGG - Intergenic
912466317 1:109877319-109877341 TGCCCCCACCTTGTGCCCCCAGG + Intergenic
912874043 1:113338017-113338039 TCACCACAACTTCTGCCTCCCGG + Intergenic
913281775 1:117191705-117191727 TCACCACACCTTCTGCCACCTGG - Intronic
913459025 1:119063901-119063923 CCCCCACACAGTGTACCTACTGG + Intronic
914250087 1:145914976-145914998 TCACCACAAACTCTGCCTCCCGG + Intronic
915526827 1:156481110-156481132 TCCCCACTGACAGTGCCTCCTGG + Intronic
915808106 1:158876451-158876473 TCCCCGCAACCTGTGCCTCCCGG + Intergenic
917111801 1:171556359-171556381 CCCCCACCCCTTGTGCTTCCTGG + Intronic
917897131 1:179502487-179502509 TCACCACAAACTTTGCCTCCCGG - Intronic
918288148 1:183078918-183078940 TCACCACAAACTCTGCCTCCTGG - Intronic
919256238 1:195128530-195128552 GCCCCACACAGAGTCCCTCCTGG - Intergenic
920927947 1:210360383-210360405 TCACCACAACTTCTGCCTCCTGG + Intronic
922291026 1:224208938-224208960 TCACCAAAAATTCTGCCTCCTGG - Intergenic
922532816 1:226357336-226357358 TCCCTACAACTTCTGCCTCCCGG - Intergenic
922859792 1:228806593-228806615 TCCCAACAAATCTTGCCTCCAGG - Intergenic
923297857 1:232612277-232612299 TCCCCACACAGAGTCCCTACTGG + Intergenic
923307205 1:232699070-232699092 TCACCACAACTTCTGCCTCCCGG - Intergenic
923364294 1:233244634-233244656 TCACCACAACTTCTGCCTCCTGG - Intronic
923421278 1:233817753-233817775 TCTCCAAACATTATGTCTCCTGG - Intergenic
1064216904 10:13408067-13408089 TCACCACAACTTTTGCCTCCCGG - Intergenic
1064296659 10:14084870-14084892 TCCTCACTCCTTCTGCCTCCTGG + Intronic
1064483781 10:15765041-15765063 TCACCACACATGCTGCCTCAGGG - Intergenic
1064885779 10:20110666-20110688 TGCCCCCACACTGTTCCTCCCGG + Intronic
1064990608 10:21253616-21253638 TCACCACAACTTCTGCCTCCTGG + Intergenic
1065018960 10:21486814-21486836 TCACCACAAACTCTGCCTCCCGG - Intergenic
1065847992 10:29762001-29762023 TCCAGTCAGATTGTGCCTCCTGG - Intergenic
1066562679 10:36687685-36687707 TCCCCACACCTTCTTCATCCTGG - Intergenic
1067814722 10:49464947-49464969 TCCCCACACAGAGTCCCTACTGG + Intronic
1067956301 10:50795246-50795268 TCCCCACACAGAGTCCCTACTGG + Intronic
1067977764 10:51044905-51044927 TCCCCAGACATTTGGCTTCCAGG - Intronic
1068676807 10:59777502-59777524 CCCCCACACAGAGTCCCTCCTGG - Intergenic
1069368865 10:67723059-67723081 TCACCACAACTTCTGCCTCCTGG + Intergenic
1069676376 10:70251571-70251593 TCCCCACCCAGAGGGCCTCCTGG - Exonic
1070615718 10:77967913-77967935 TCCCCACATTTTCTGCCTTCGGG - Intergenic
1070733997 10:78851199-78851221 ACCCCACCCATTGTGTGTCCAGG - Intergenic
1070748155 10:78947646-78947668 TGCCCACACCCTGTGTCTCCAGG + Intergenic
1070845388 10:79518541-79518563 TCACCACAACCTGTGCCTCCTGG - Intergenic
1070928405 10:80241773-80241795 TCACCACAACCTGTGCCTCCTGG + Intergenic
1071018928 10:81029475-81029497 TCCCCACACAGAGTCCCTACTGG - Intergenic
1071284480 10:84131831-84131853 TTCCCACCCATTGTTCCTCTAGG + Intergenic
1071291204 10:84190582-84190604 TGCCCACTCATTCTGACTCCTGG - Intergenic
1071548499 10:86547175-86547197 TCACCACAACTTCTGCCTCCTGG - Intergenic
1072287260 10:93927878-93927900 CCCCCACCCCTTGTGCTTCCTGG - Intronic
1073215885 10:101836009-101836031 TCCCCCTAAATTGGGCCTCCTGG - Intronic
1075530527 10:123225275-123225297 TCCCCACACAGAGTCCCTACTGG - Intergenic
1075921530 10:126217440-126217462 TCACCACAACTTCTGCCTCCAGG + Intronic
1076240161 10:128898997-128899019 TCCCCACACTTTTTGCCTGTGGG - Intergenic
1079114063 11:17629369-17629391 CCCCCACACATAATTCCTCCTGG + Intronic
1079143868 11:17833473-17833495 TCCCCACACAGAGTCCCTACTGG + Intronic
1080886395 11:36371981-36372003 TCCCTGCAAATTCTGCCTCCTGG - Intronic
1080956848 11:37107531-37107553 TCCCCAAACATTGTTCCTTCAGG - Intergenic
1081618473 11:44604490-44604512 TGCCCACTCACTGTGCCTCATGG - Intronic
1082078791 11:47995961-47995983 TCACCACAACCTGTGCCTCCCGG - Intronic
1083067195 11:59937045-59937067 TCCCCGCACTCTCTGCCTCCTGG - Intergenic
1083159490 11:60846168-60846190 TCCCAACACCTTGTCCCTTCAGG + Intronic
1083810615 11:65104001-65104023 TCACTACAACTTGTGCCTCCAGG + Intronic
1085433730 11:76480798-76480820 TCCCAACCCCTTGTGCTTCCTGG - Intronic
1085516499 11:77114986-77115008 TCACCACAATTTCTGCCTCCCGG - Intronic
1085588786 11:77737371-77737393 TCCCTGCAAATTCTGCCTCCCGG - Intronic
1085861845 11:80244388-80244410 CCCCCACACAGAGTCCCTCCTGG + Intergenic
1087023149 11:93623304-93623326 TCACAACACTTTCTGCCTCCAGG - Intergenic
1087377635 11:97365014-97365036 TACCCACAGATGGAGCCTCCAGG + Intergenic
1087667715 11:101070205-101070227 TCCCCACTCTTTGTACTTCCCGG - Intronic
1088037067 11:105329903-105329925 TCACCACAACTTCTGCCTCCTGG - Intergenic
1088388792 11:109290611-109290633 TCCCCACACAGTGTCCCCACTGG - Intergenic
1090637889 11:128703766-128703788 TCACCACAACTTCTGCCTCCTGG - Intronic
1090791521 11:130094126-130094148 TCACCACAACTTCTGCCTCCCGG + Intronic
1092607751 12:10138538-10138560 TCACCACAAACTCTGCCTCCCGG + Intergenic
1093004347 12:14035656-14035678 CCCCCACCCCTTGTGCTTCCCGG - Intergenic
1093150184 12:15611572-15611594 TCACCACAAACTCTGCCTCCTGG + Intergenic
1093626918 12:21360599-21360621 CCCCCACCCCTTGTGCTTCCTGG - Intronic
1095656250 12:44672504-44672526 TCCCCAGTCTTTTTGCCTCCAGG - Intronic
1096336542 12:50761162-50761184 TCACCACAAATTCCGCCTCCTGG + Intergenic
1096811915 12:54176149-54176171 TCACCACAACTTCTGCCTCCCGG - Intronic
1096820113 12:54227263-54227285 TCACTACACCTTCTGCCTCCTGG - Intergenic
1096948644 12:55440206-55440228 TCTCCACATATTTTTCCTCCTGG + Intergenic
1098061681 12:66569712-66569734 CCCCCACACTCTGTGCCTCCAGG + Intronic
1098661062 12:73094367-73094389 CCCCCACACAGTGTTCCTACTGG + Intergenic
1099722579 12:86382976-86382998 CCCCCACACAGAGTGCCTACTGG + Intronic
1099846144 12:88031017-88031039 CCCCCACACAGAGTCCCTCCTGG - Intronic
1100337161 12:93642075-93642097 TCCCAACAGATCATGCCTCCTGG - Intergenic
1100543919 12:95583728-95583750 TCTCCACAATTTCTGCCTCCCGG + Intergenic
1101986245 12:109449649-109449671 TTACCACAACTTGTGCCTCCTGG - Exonic
1102179992 12:110905203-110905225 CCCTGACCCATTGTGCCTCCAGG + Intronic
1103551531 12:121741402-121741424 TCACCACAACCTGTGCCTCCCGG + Intronic
1104522254 12:129486597-129486619 TCCCCACTCATTGTGTGTCCAGG + Intronic
1104541439 12:129669628-129669650 TCACCACAACTTTTGCCTCCTGG - Intronic
1104676357 12:130714729-130714751 TCCCCTCACACCGTGCCCCCAGG + Intronic
1104722177 12:131050694-131050716 TCCCCAGACATTTTGGCACCAGG + Intronic
1105981700 13:25523041-25523063 TCACCACAACCTGTGCCTCCTGG - Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106235774 13:27858926-27858948 TCACCACAACTTTTGCCTCCCGG - Intergenic
1106316092 13:28595365-28595387 TCACCACAACCTGTGCCTCCCGG + Intergenic
1107160618 13:37222906-37222928 TCACCACACCCTCTGCCTCCCGG - Intergenic
1107389695 13:39951386-39951408 TGCCCATATTTTGTGCCTCCAGG + Intergenic
1107535233 13:41323084-41323106 GCCCCACACAGCGTGCCTCCTGG + Exonic
1108338626 13:49473474-49473496 TCCCCACAACATCTGCCTCCTGG - Intronic
1108790704 13:53966462-53966484 TCCCCACACAGAGTCCCTACTGG + Intergenic
1109107914 13:58278072-58278094 TCCCCACACAGAGTCCCTACTGG - Intergenic
1110543160 13:76728165-76728187 CCCCCACACAGTGTCCCTACTGG + Intergenic
1110880015 13:80559755-80559777 TCACCACAAGTTCTGCCTCCCGG - Intergenic
1111246834 13:85551508-85551530 TCCACACAGAGTTTGCCTCCTGG - Intergenic
1111770024 13:92585082-92585104 ACCCCACACAGAGTCCCTCCTGG + Intronic
1112020972 13:95370957-95370979 TCACCACAACTTCTGCCTCCCGG + Intergenic
1112920441 13:104605129-104605151 TCACCACAACTTCTGCCTCCCGG - Intergenic
1113868598 13:113544684-113544706 GCTCCACAGATGGTGCCTCCTGG + Intronic
1113987371 13:114329057-114329079 TCACCACAAACTCTGCCTCCCGG + Intergenic
1114304724 14:21412218-21412240 TCTCCACAACTTTTGCCTCCCGG + Intronic
1114457322 14:22864604-22864626 TCACCACAAACTCTGCCTCCCGG + Intergenic
1115010857 14:28542976-28542998 TCCCCTCATATGGTGCTTCCTGG + Intergenic
1115985074 14:39096453-39096475 TCACCACAAACTTTGCCTCCAGG - Intronic
1116986229 14:51222910-51222932 TCCCCACACATACTCCCTACTGG - Intergenic
1117416588 14:55502162-55502184 TCACCACATCTTCTGCCTCCTGG + Intergenic
1117630338 14:57684322-57684344 TCCCCACACTTTTTGGCACCGGG + Intronic
1118239622 14:64043844-64043866 CCCCCACACAGAGTGCCTACTGG + Intronic
1119083950 14:71722808-71722830 TCACCACAACTTCTGCCTCCCGG + Intronic
1119669561 14:76508195-76508217 TGCCCCCACACTGTGCTTCCTGG + Intergenic
1120095552 14:80384098-80384120 TCACCACAACTTCTGCCTCCTGG + Intronic
1120132520 14:80823872-80823894 TCCCCGCACATTGTCCCTACTGG - Intronic
1120161149 14:81145949-81145971 TCCCCACAGATGGTCCCTGCTGG + Exonic
1120271851 14:82322353-82322375 CCCCCACCCCTTGTGCTTCCTGG + Intergenic
1120454683 14:84716670-84716692 TCCCCACACAGAGTCCCTGCTGG + Intergenic
1120788422 14:88557634-88557656 TCGCCACAACCTGTGCCTCCTGG - Intergenic
1120794663 14:88619288-88619310 TCACCACAACCTGTGCCTCCTGG - Exonic
1121765183 14:96479830-96479852 GGCCCACACCTTGGGCCTCCAGG + Intronic
1122904682 14:104796184-104796206 TCCCAAGACCTTGTGCCTCTGGG + Intergenic
1125279299 15:38027061-38027083 CCCCCACACAGAGTCCCTCCTGG + Intergenic
1125460986 15:39906551-39906573 CCCCCACACATTATGCTGCCTGG + Intronic
1125502854 15:40250269-40250291 TCCCCACACATTGAGACAGCTGG - Intronic
1125598845 15:40904511-40904533 TCACCACAAACTCTGCCTCCCGG - Intergenic
1127373654 15:58362779-58362801 CCCCAACCCCTTGTGCCTCCTGG - Intronic
1127536766 15:59897184-59897206 ACCCTTCACCTTGTGCCTCCAGG - Intergenic
1127693057 15:61416354-61416376 TCACCACAACCTGTGCCTCCTGG + Intergenic
1127873963 15:63096929-63096951 TCACCACAACTTCTGCCTCCCGG + Intergenic
1128001452 15:64196524-64196546 TCACCACAAACTCTGCCTCCCGG + Intronic
1129437543 15:75554267-75554289 TCACCACAACTTCTGCCTCCCGG + Intronic
1130245022 15:82239209-82239231 TCACCACACGCTCTGCCTCCCGG + Intronic
1131073726 15:89481874-89481896 TCACCACAACCTGTGCCTCCTGG + Intronic
1131752608 15:95526006-95526028 TCCCCACACAGTGTCCCTACTGG - Intergenic
1131779579 15:95842168-95842190 TCACTACAACTTGTGCCTCCAGG + Intergenic
1132298858 15:100764119-100764141 TCCTCACACTTTGTGCTGCCTGG - Intergenic
1132954268 16:2583112-2583134 TCACCGCAAATTCTGCCTCCCGG + Intronic
1132960077 16:2617051-2617073 TCACCGCAAATTCTGCCTCCCGG - Intergenic
1133462314 16:5997591-5997613 GGCACTCACATTGTGCCTCCTGG + Intergenic
1133681174 16:8121619-8121641 TCACCACAACTTTTGCCTCCCGG + Intergenic
1134637850 16:15806200-15806222 TCACCACAAACTCTGCCTCCTGG - Intronic
1136402151 16:30024857-30024879 TCTCCCCACATTCTGACTCCTGG + Exonic
1138088289 16:54153736-54153758 TCCCCACACGCTCTGCCTCAAGG - Intergenic
1138244674 16:55458591-55458613 TCACCACAACTTCTGCCTCCCGG - Intronic
1140119588 16:72072081-72072103 TCACCACAACTTCTGCCTCCTGG + Intronic
1140171656 16:72610949-72610971 TCACCACAAATTCTGCCTCCCGG - Intergenic
1141081910 16:81060381-81060403 TCACCACAAACTCTGCCTCCCGG + Intronic
1141265536 16:82493773-82493795 TCCCCAACCAGTGTTCCTCCAGG + Intergenic
1141334232 16:83139925-83139947 TCACCACAACTTCTGCCTCCTGG - Intronic
1141921645 16:87139502-87139524 TTTCCAAACATTGTGCCTCAGGG - Intronic
1142137709 16:88459262-88459284 TCCCCACAGAGTGGGCCTCCCGG + Intronic
1203138162 16_KI270728v1_random:1743296-1743318 TCCCTACAACTTCTGCCTCCTGG + Intergenic
1142647880 17:1327218-1327240 TCACCACAACTTCTGCCTCCTGG + Intergenic
1142882600 17:2893610-2893632 AGCCCACACCTTGTGACTCCCGG + Intronic
1143088156 17:4432464-4432486 TCACCACAACCTGTGCCTCCCGG + Intergenic
1143197199 17:5085112-5085134 TCACTACAACTTGTGCCTCCTGG + Intronic
1143332017 17:6144518-6144540 TCACCACAAACTCTGCCTCCCGG + Intergenic
1144817915 17:18049259-18049281 TCACCACAAACTCTGCCTCCTGG - Intronic
1144860235 17:18297348-18297370 TCACCACAACTTCTGCCTCCCGG - Intronic
1146328780 17:31910226-31910248 TCACCACAAACTCTGCCTCCCGG - Intergenic
1146381444 17:32332215-32332237 TCACCACAAACTCTGCCTCCTGG + Intronic
1146561118 17:33871473-33871495 TCTCCACTCATTGTCCATCCTGG - Intronic
1147181291 17:38687456-38687478 TCCCCCCACATTGCTTCTCCTGG + Intergenic
1147878555 17:43639076-43639098 TCACCACAAACTCTGCCTCCCGG - Intergenic
1147951728 17:44111331-44111353 TCCCCCCCCATGGGGCCTCCTGG - Intronic
1148834525 17:50458863-50458885 TCCCCCCACAGTCTGCCTCATGG + Intronic
1149365099 17:55936122-55936144 TCCCCACAACCTCTGCCTCCTGG + Intergenic
1149588300 17:57808380-57808402 TCCCCAACCTTTGTGCCACCAGG - Intergenic
1149773070 17:59336441-59336463 GCCCCACATATAGTGCCTCCTGG - Intronic
1150025814 17:61673230-61673252 TCCCAACCCCTTGTGCTTCCTGG - Intergenic
1150556280 17:66257566-66257588 TCACCACAACTTCTGCCTCCCGG + Intergenic
1150687404 17:67331814-67331836 TCCCCACACAGAGTCCCTACTGG + Intergenic
1152985929 18:321127-321149 TCCCCACAACCTCTGCCTCCTGG + Intronic
1154952390 18:21223051-21223073 TCACCACACCGTCTGCCTCCCGG + Intergenic
1155219865 18:23674575-23674597 TCACCACAACTTCTGCCTCCTGG + Intergenic
1156012143 18:32507878-32507900 TCCCCAGTTATTGTGCCGCCTGG + Intergenic
1156021348 18:32603066-32603088 TCACCACAACTTCTGCCTCCTGG + Intergenic
1157242428 18:46023482-46023504 TGACCACAAATTCTGCCTCCCGG - Intronic
1157377850 18:47182553-47182575 CCCCCACACAGAGTCCCTCCTGG + Intergenic
1157742168 18:50103135-50103157 TGCCCACAAAGTGGGCCTCCTGG - Intronic
1157980767 18:52377779-52377801 TCACCACAGATTCTGCCTCCCGG + Intronic
1158568336 18:58574728-58574750 TCCCCAAACATTTTGGCACCAGG - Intronic
1159206478 18:65259502-65259524 TCACCACAAACTCTGCCTCCTGG - Intergenic
1159508046 18:69360940-69360962 TCCCCACACAGAGTCCCTACTGG + Intergenic
1160003732 18:75052740-75052762 TTCCCACACAAAGTGCCTTCTGG + Intronic
1160341036 18:78088857-78088879 TCCCCACCCACCCTGCCTCCTGG - Intergenic
1161108021 19:2454216-2454238 TCCCCGCACCCTCTGCCTCCCGG - Intronic
1161352609 19:3802241-3802263 TCACCACAACTTCTGCCTCCCGG + Intergenic
1161378888 19:3954156-3954178 TGCCCATACATGGAGCCTCCCGG + Intergenic
1162181802 19:8874409-8874431 TCACCACAACCTGTGCCTCCCGG - Intronic
1162572751 19:11482357-11482379 TCCCCACCCCGTGTTCCTCCCGG + Intronic
1162984501 19:14260917-14260939 TCACCACAACTTCTGCCTCCCGG + Intergenic
1163708580 19:18832198-18832220 TCCACGCTCATGGTGCCTCCGGG - Exonic
1164014282 19:21238287-21238309 TCACCACAACTTCTGCCTCCTGG - Intronic
1164174908 19:22763981-22764003 TCACCACAACTTCTGCCTCCCGG + Intronic
1165004497 19:32793867-32793889 TCACCACAACCTGTGCCTCCCGG + Intronic
1165115590 19:33526622-33526644 TCACCACAACTTCTGCCTCCTGG + Intergenic
1165408007 19:35642488-35642510 TCCCCACAGGAAGTGCCTCCAGG + Exonic
1166740401 19:45111347-45111369 TCACCACAACTTCTGCCTCCCGG + Intronic
1167538298 19:50069419-50069441 TTCCAACACCTGGTGCCTCCTGG - Intergenic
1167824651 19:51961224-51961246 TCCCCACACTCTCTGCCTTCAGG + Intergenic
1167986814 19:53325297-53325319 TCCCCAGTCATTCTGGCTCCAGG - Intergenic
925650341 2:6082776-6082798 TCCCCACACAGCAGGCCTCCAGG + Intergenic
927975264 2:27333769-27333791 TTGCCACACATTGTACCTGCAGG + Exonic
928545387 2:32324542-32324564 TCACCACACCCTCTGCCTCCCGG - Intergenic
929157611 2:38802188-38802210 TCCCCTCACAGTGTGCTTTCTGG + Intronic
929528795 2:42732136-42732158 TCCCCACACAGAGTCCCTACTGG - Intronic
930029348 2:47048919-47048941 GCACCACACTTTGTGCCTCCTGG + Intronic
930101155 2:47604400-47604422 TCACCACAAACTCTGCCTCCCGG - Intergenic
931270878 2:60701467-60701489 TCGCCACAAACTTTGCCTCCTGG - Intergenic
931592914 2:63905622-63905644 TCCCCACAAATTCTTCTTCCAGG + Intronic
932348987 2:71016793-71016815 TGCACACACATTGTGACTTCAGG + Intergenic
932524029 2:72444459-72444481 TCCCCACACAGAGTCCCTACTGG - Intronic
932962643 2:76432263-76432285 TCACCGCAAACTGTGCCTCCCGG + Intergenic
933064158 2:77772931-77772953 TCCCCACACAGAGTCCCTACTGG - Intergenic
933065052 2:77781938-77781960 CCCCCACACATTGTCTCTACCGG + Intergenic
934129842 2:88937556-88937578 TCACCACAAGTTCTGCCTCCCGG + Intergenic
935258592 2:101334800-101334822 TCACCACAACTTCTGCCTCCCGG - Intergenic
936640348 2:114304563-114304585 TCCCGACCCCTTGTGCTTCCTGG + Intergenic
937892326 2:126948216-126948238 TGCCCACACAGTGAGCTTCCTGG - Intergenic
938868831 2:135452921-135452943 CCCCCACACAGTGTCCCTACTGG - Intronic
938946092 2:136213305-136213327 TCCCCACTCATTGTCCCTGGAGG - Intergenic
939137602 2:138315489-138315511 CCCCCACACAGAGTCCCTCCTGG - Intergenic
939498264 2:142949324-142949346 CCCCCACACAGTGTACCTACTGG - Intronic
939559256 2:143714030-143714052 TCCCCACACAGAGTCCCTTCTGG - Intronic
941450278 2:165652615-165652637 TCCCCACAACCTCTGCCTCCTGG + Intronic
941663833 2:168223434-168223456 TCACCACAACTTCTGCCTCCTGG - Intronic
941955283 2:171197702-171197724 TCCCTACAACTTCTGCCTCCCGG - Intronic
942586162 2:177480103-177480125 TCACCACAACCTGTGCCTCCTGG - Intronic
942791208 2:179762977-179762999 TCACCACAACCTGTGCCTCCTGG + Intronic
943219852 2:185090712-185090734 TCCCCACACAGAGTCCCTACTGG + Intergenic
943591439 2:189802606-189802628 TCACCTCACATTAAGCCTCCAGG + Intronic
943755072 2:191548980-191549002 TCACCACAAACTCTGCCTCCTGG - Intergenic
943832912 2:192485411-192485433 TCCCCACACAGAGTCCCTACTGG + Intergenic
943871671 2:193008139-193008161 TCCCCACACAGTGTCCCTACTGG - Intergenic
944307437 2:198194281-198194303 TCCCCACACAGAGTCCCCCCTGG - Intronic
944687674 2:202132099-202132121 TCACCACAAACTCTGCCTCCTGG - Intronic
945390652 2:209261591-209261613 TCCCAACCCCTTGTGCTTCCCGG - Intergenic
945955950 2:216085794-216085816 TCACCACAACTTCTGCCTCCTGG - Intronic
946285563 2:218699996-218700018 TCACCACAACTTCTGCCTCCCGG + Intronic
946455135 2:219819439-219819461 TCCTGACCCCTTGTGCCTCCCGG + Intergenic
947483546 2:230525619-230525641 CCCCCACCCCTTGTGCTTCCTGG - Intronic
947489693 2:230582914-230582936 ACCCCATACATTGTCCCTCTGGG + Intergenic
947610339 2:231521469-231521491 TCCTCACTCCCTGTGCCTCCAGG - Intergenic
948112391 2:235466697-235466719 TCCCTACAACTTCTGCCTCCTGG + Intergenic
948200250 2:236124424-236124446 TCCCCATCCCTTGTGCCACCAGG - Exonic
948647542 2:239416656-239416678 TCACCACAACTTCTGCCTCCTGG + Intergenic
948845093 2:240679297-240679319 TCCCCACACACTGGGCCTGCAGG - Intronic
948848767 2:240695582-240695604 TCCCCACACACTGGGCCTGCAGG + Intronic
948893405 2:240917556-240917578 CTCCCCCACCTTGTGCCTCCTGG - Intergenic
1171240416 20:23563170-23563192 TACCCACACATTCAGCCTTCAGG - Intergenic
1171303217 20:24082282-24082304 TTCCCTCACATTCTGCATCCAGG + Intergenic
1171773784 20:29347541-29347563 TCACCACAACTTTTGCCTCCTGG + Intergenic
1171775092 20:29358500-29358522 TCACCACAACTTCTGCCTCCTGG - Intergenic
1172161243 20:32869682-32869704 CCCCCATACTGTGTGCCTCCTGG - Intronic
1172378246 20:34464399-34464421 TCACCACAACTTCTGCCTCCTGG + Intronic
1174477038 20:50802797-50802819 TCACCACAAACTCTGCCTCCCGG - Intronic
1176105159 20:63382432-63382454 TCCCCACCCATTTTACCCCCAGG + Intergenic
1176276541 20:64273683-64273705 TCCCCACAACGTCTGCCTCCAGG - Exonic
1177077775 21:16599302-16599324 TCACCACACCCTCTGCCTCCTGG - Intergenic
1177206608 21:18017712-18017734 GCCCCACACAGTGTGCCCACTGG + Intronic
1178099563 21:29253061-29253083 CCCCCACACAGAGTGCCTACTGG - Intronic
1178301547 21:31457789-31457811 TCCCCCCACCTCCTGCCTCCAGG + Intronic
1178947963 21:36963675-36963697 TCCCCGCAACTTCTGCCTCCCGG - Intronic
1179283806 21:39958581-39958603 TCACCACAAACTCTGCCTCCTGG + Intergenic
1179332092 21:40413202-40413224 TCCCCACACAGAGTACCTACTGG + Intronic
1179429272 21:41308612-41308634 TCACCACAACCTGTGCCTCCTGG + Intronic
1179465405 21:41568359-41568381 CCACCACAGATTCTGCCTCCTGG + Intergenic
1180251417 21:46592602-46592624 CCCCCACACAGAGTTCCTCCTGG + Intergenic
1180595229 22:16968584-16968606 TACCCACACAGTGTCCCTCCTGG + Intronic
1180958683 22:19752382-19752404 GCCCCACACCCTGTGCCTCTCGG - Intergenic
1180976104 22:19849441-19849463 TCACCACACCCTCTGCCTCCTGG + Exonic
1181167021 22:20989349-20989371 TCCTCACTCAGTGTCCCTCCTGG - Intronic
1181867849 22:25873513-25873535 TCACCACAACTTCTGCCTCCCGG + Intronic
1182706915 22:32288619-32288641 TCACCACAACTTCTGCCTCCCGG + Intergenic
1184324158 22:43769927-43769949 TCACCACAAACTCTGCCTCCCGG + Intronic
1185016978 22:48350288-48350310 TGCCCAGACATTTTGCCTCTAGG + Intergenic
949640466 3:6030285-6030307 CCCCAACACCTTGTGCTTCCTGG + Intergenic
949803256 3:7926541-7926563 TCACCGCACACTCTGCCTCCCGG - Intergenic
950505031 3:13389272-13389294 TCCCCACCCCTTGAGCTTCCAGG - Intronic
951199687 3:19863063-19863085 TCCCCACACAGAGTCCCTACTGG - Intergenic
951345532 3:21543380-21543402 TCCCCACCCCTTGTCGCTCCTGG + Intronic
953721393 3:45358555-45358577 TCACCACAACTTCTGCCTCCCGG + Intergenic
954797880 3:53170681-53170703 TCCCCAGCCATTGTGCCTGGGGG + Intronic
955056954 3:55463345-55463367 TCACCACAACTTCTGCCTCCCGG + Intergenic
955471875 3:59294771-59294793 TCCCCCCACATAGTCCCTACTGG - Intergenic
956547761 3:70424877-70424899 TCTCCAGACATTGTACCTCGAGG + Intergenic
956683250 3:71801664-71801686 TCACCACACCCTCTGCCTCCTGG + Intergenic
957811627 3:85229391-85229413 TCCCGACCCCTTGTGCTTCCTGG + Intronic
958440037 3:94145524-94145546 TCACCACAACTTCTGCCTCCCGG + Intergenic
959097444 3:101971359-101971381 CCCCAACCCCTTGTGCCTCCCGG + Intergenic
959113784 3:102152058-102152080 TCCCCACACATAGTTCCCACTGG - Intronic
959323160 3:104904422-104904444 TCCCCACAGACTGAGGCTCCAGG - Intergenic
960890493 3:122443010-122443032 CCCCGACCCATTGTGCTTCCTGG - Intronic
961100131 3:124191554-124191576 TCCCCCTACATTGTGTCTGCTGG + Intronic
961506536 3:127374298-127374320 TCCCCAGACACCGTGGCTCCTGG + Intergenic
962110521 3:132441239-132441261 TCCCCACAAATTTTACCTGCTGG - Intronic
962156774 3:132956585-132956607 TCCTCACCCCTTGTGCTTCCCGG - Intergenic
962258373 3:133887327-133887349 CTCCCCCACATTGTGCCCCCAGG + Intronic
962474984 3:135747635-135747657 TCCACACCAATAGTGCCTCCCGG + Intergenic
962997715 3:140647802-140647824 TCCCCAGACAGAGAGCCTCCAGG - Intergenic
963422060 3:145073209-145073231 CCCCCACACAGTGTCCCTACCGG - Intergenic
963780516 3:149481653-149481675 TCTCCACACATGGTGTGTCCTGG - Intronic
963921523 3:150910264-150910286 TTCCCACCCAGTGTGACTCCAGG - Intronic
963952859 3:151221808-151221830 CCCCCACACAGAGTGCCTACTGG + Intronic
964088554 3:152847046-152847068 CCCCCACACAGAGTGCCTACTGG + Intergenic
964269992 3:154945341-154945363 CCCCCACCCCTTGTGCTTCCAGG - Intergenic
965149168 3:164947593-164947615 TCACCACAAATTCCGCCTCCCGG - Intergenic
965161627 3:165140305-165140327 TCCCAACCCCTTGTGCTTCCCGG + Intergenic
965594150 3:170391390-170391412 TCCCCACAACCTCTGCCTCCCGG + Intronic
966742007 3:183242699-183242721 TCCCCACACAGAGTGCCCACTGG + Intronic
966884643 3:184370020-184370042 TCACCACAACTTCTGCCTCCCGG + Intronic
967689560 3:192458218-192458240 TCCCCACACAGAGTCCCTACTGG + Intronic
968147168 3:196309338-196309360 TCACCACAAACTCTGCCTCCTGG + Intronic
968331572 3:197874995-197875017 TCCCCACAACCTCTGCCTCCCGG + Intronic
969833678 4:9819857-9819879 TCACCACAACTTCTGCCTCCCGG - Intronic
970801308 4:19976352-19976374 CCCCCACACAGTGTCCCTACTGG - Intergenic
972045882 4:34664219-34664241 GCCCCACAGATTCTGGCTCCAGG - Intergenic
972609540 4:40644082-40644104 TCACCACAACCTGTGCCTCCTGG + Intergenic
974271026 4:59651736-59651758 TCCCCACACAGAGTCCCTACTGG + Intergenic
975234599 4:71977434-71977456 TCACTACAACTTGTGCCTCCTGG - Intergenic
975581161 4:75907987-75908009 TCACCACAGACTCTGCCTCCTGG - Intergenic
976090475 4:81452183-81452205 TCACCACAATTTCTGCCTCCCGG + Intronic
976715861 4:88122045-88122067 CCCCCACCCCTTGTGCTTCCTGG - Intronic
976975907 4:91165867-91165889 CCCCAACCCATTGTGCTTCCTGG + Intronic
977592500 4:98842302-98842324 CCCCCACACAGAGTCCCTCCTGG + Intergenic
979065907 4:116132713-116132735 TCCCCACACAGAGTTCCTACTGG - Intergenic
979391879 4:120138016-120138038 CCCCCACACAGAGTCCCTCCTGG - Intergenic
979443374 4:120779826-120779848 TCTCCACAACCTGTGCCTCCTGG - Intronic
979462894 4:121003561-121003583 TCACCACAATCTGTGCCTCCTGG - Intergenic
980037845 4:127905438-127905460 TCCCAACCCCTTGTGCTTCCTGG + Intergenic
980286848 4:130790572-130790594 TCACCACAACTTCTGCCTCCCGG + Intergenic
980293615 4:130879016-130879038 TCACCACACACTCCGCCTCCCGG + Intergenic
980352406 4:131699531-131699553 TCCCCACACAGAGTCCCTACTGG - Intergenic
981207110 4:142055756-142055778 TCCCCACACTTTTTGGCACCAGG + Intronic
981281650 4:142966087-142966109 CCCCCACACAGAGTGCCTACTGG - Intergenic
981316023 4:143340257-143340279 TCCACAAACATTTTGCCTACTGG - Intronic
981654964 4:147102493-147102515 TCACCACAACTTCTGCCTCCCGG - Intergenic
981695704 4:147556806-147556828 ACACCACACATAGTGCCTGCTGG + Intergenic
982832109 4:160075544-160075566 TCACCACAACTTCTGCCTCCTGG + Intergenic
983004719 4:162469676-162469698 ATCCCACACATTCTGCCTCCAGG + Intergenic
983031727 4:162811243-162811265 TCCCCAAACTTTTTGCCACCAGG + Intergenic
983034360 4:162844454-162844476 TCACCACAAACTCTGCCTCCCGG - Intergenic
983182689 4:164667572-164667594 TCCCAACCCACTGTGCTTCCCGG - Intergenic
983437245 4:167731292-167731314 TCCCCACACAGAGTGCCTACTGG + Intergenic
983785932 4:171729422-171729444 TCCCCACACAGAGTCCCTACTGG + Intergenic
984787551 4:183582990-183583012 TCACCACAACTTCTGCCTCCCGG + Intergenic
986088280 5:4475605-4475627 TCACCACAACTTCTGCCTCCCGG - Intergenic
986105491 5:4655786-4655808 CCCCCACACAGTGTCCCTACTGG - Intergenic
986246520 5:6012070-6012092 TCCTCACACATAGTCCCTACTGG - Intergenic
986627863 5:9739381-9739403 GCCCAACACATAGTGCCTCCAGG - Intergenic
987602064 5:20084531-20084553 TCCCCACACAGAGTTCCTACTGG - Intronic
988787716 5:34579804-34579826 TCCCCACACATTCAGCCCCCAGG + Intergenic
989093557 5:37759356-37759378 TCACCGCACCTTCTGCCTCCCGG - Intergenic
989662653 5:43816028-43816050 TCTCCACACATAGTCCCTACTGG + Intergenic
991575819 5:68102411-68102433 CCCCCACCCCTTGTGCTTCCAGG - Intergenic
992119412 5:73575795-73575817 TCACCGCACCTTCTGCCTCCTGG + Intronic
992688299 5:79219078-79219100 TCACCACAACTTCTGCCTCCCGG + Intronic
993211677 5:84960904-84960926 TCCCCAAACATTTTGTCACCAGG + Intergenic
993911444 5:93689765-93689787 TCACCACAACTTCTGCCTCCTGG + Intronic
994039648 5:95244386-95244408 CCCCCACCCCTTGTGCTTCCCGG - Intronic
994895577 5:105697975-105697997 CCCCCACACAGAGTGCCTACTGG - Intergenic
995051511 5:107711380-107711402 TCCCTACAACTTCTGCCTCCTGG + Intergenic
996460210 5:123732797-123732819 CCCCCACACAGTGTCCCTACTGG + Intergenic
996793228 5:127315978-127316000 TTCCCACACATTGTTCTTTCTGG + Intronic
997221980 5:132176810-132176832 TCCCCAGACATTTTGGCACCAGG - Intergenic
997938040 5:138131472-138131494 TCACCACAACTTCTGCCTCCTGG - Intronic
999386761 5:151159045-151159067 TCACCACAACTTCTGCCTCCTGG + Intergenic
999910056 5:156187921-156187943 TCACCATACCTTGTACCTCCTGG - Intronic
1000354128 5:160377162-160377184 TCACCACAATTTCTGCCTCCCGG + Intergenic
1000564869 5:162834810-162834832 TCCCCACACACAGTCCCTACTGG - Intergenic
1001812259 5:174637907-174637929 TCCCCACTCATTCTGCCTCCTGG + Intergenic
1005805540 6:29471291-29471313 TCCCCGCACTTTTTCCCTCCCGG + Intergenic
1005859707 6:29890767-29890789 CCTCCACACATTATGCCTACAGG - Intergenic
1005949793 6:30623260-30623282 TCACCACAACCTGTGCCTCCTGG - Intronic
1006616398 6:35330540-35330562 TCACCACAACTTCTGCCTCCAGG - Intergenic
1006826285 6:36938656-36938678 TTCCCACACAGTGTGCCTCTGGG + Intergenic
1007400793 6:41601176-41601198 TCACCACACAGTGTGCCACGTGG - Exonic
1007480809 6:42148698-42148720 TCACCACAACTTCTGCCTCCTGG + Intergenic
1007560193 6:42801174-42801196 TCACCACAGACTCTGCCTCCAGG - Intronic
1007856594 6:44864400-44864422 TCCCCACACAGAGTCCCTACTGG - Intronic
1008820938 6:55629984-55630006 TCCCCACACAGTGTCCCTATTGG + Intergenic
1009393233 6:63167164-63167186 CCCCCACCCCTTGTGCTTCCTGG - Intergenic
1009538644 6:64924011-64924033 TCCCCACACAGAGTCCCTACTGG - Intronic
1009634926 6:66253088-66253110 CCCCCACACAGAGTGCCTACTGG - Intergenic
1009709692 6:67300889-67300911 TCCCAACCCCTTGTGCTTCCTGG + Intergenic
1009726089 6:67537469-67537491 TCCCCACACAATGTCCCTAGTGG + Intergenic
1009772503 6:68161278-68161300 CCCCCACACAGAGTGCCTACTGG + Intergenic
1010171850 6:72984647-72984669 CCCCCACCCCTTGTGCTTCCTGG + Intronic
1010234753 6:73566035-73566057 TCACCACACCCTCTGCCTCCTGG - Intergenic
1010448656 6:75977510-75977532 TCACCACAACTTCTGCCTCCTGG - Intronic
1010920348 6:81673065-81673087 CCCCCACACAGAGTGCCTACTGG - Intronic
1010968769 6:82242292-82242314 TCACCACAAACTCTGCCTCCTGG - Intronic
1011034841 6:82961885-82961907 TCACCACACCCTCTGCCTCCTGG - Intronic
1011378622 6:86718761-86718783 TCCCCACACAGAGTCCCTGCTGG - Intergenic
1011685753 6:89822142-89822164 TACCCCCAAATTTTGCCTCCTGG - Intergenic
1012683237 6:102209751-102209773 TCCCCACACAGAGTCCCTACTGG + Intergenic
1013077040 6:106780891-106780913 TCCCCACACAGAGTCCCTACTGG + Intergenic
1013778828 6:113708078-113708100 TCACCACAACTTCTGCCTCCTGG + Intergenic
1014143588 6:117971488-117971510 TCCCCACACAGAGTCCCTACTGG - Intronic
1015133014 6:129835611-129835633 GCCCCACCCCTTGTGCTTCCCGG - Intronic
1015255897 6:131179246-131179268 TCACCACAACTTCTGCCTCCTGG + Intronic
1015667731 6:135650611-135650633 CCCCCACACAGAGTTCCTCCTGG + Intergenic
1017464558 6:154682357-154682379 TCACCACAACTTCTGCCTCCTGG - Intergenic
1018573761 6:165236840-165236862 TCCCCACACAGTGCCCCTACTGG + Intergenic
1020373862 7:7462782-7462804 TCACCACAACTTCTGCCTCCCGG - Intronic
1020391489 7:7662574-7662596 TCCCAACCCCTTATGCCTCCTGG + Intronic
1020813766 7:12878486-12878508 TCACCACAACCTGTGCCTCCCGG - Intergenic
1021628918 7:22624258-22624280 GCCCCAATCAGTGTGCCTCCTGG - Intronic
1023046627 7:36215615-36215637 CCCCAACACATGGTGCCTACAGG - Intronic
1023703392 7:42914208-42914230 TCCCAACACTTTGTGAGTCCAGG + Intronic
1024614012 7:51092266-51092288 TCCCCACCCTTTGTGGCACCAGG - Intronic
1024738272 7:52328745-52328767 CCCCCACCCCTTGTGCTTCCTGG + Intergenic
1024946212 7:54809676-54809698 TCACCACAACTTCTGCCTCCTGG + Intergenic
1025711685 7:63916991-63917013 TCGCCACAAACTCTGCCTCCCGG + Intergenic
1025740326 7:64191235-64191257 TCACCACAATTTCTGCCTCCTGG + Intronic
1027160956 7:75801723-75801745 TCCCCACAACCTCTGCCTCCCGG - Intergenic
1027461667 7:78461834-78461856 TCACCACAACTTCTGCCTCCTGG - Intronic
1027928566 7:84500191-84500213 TGTGCACACATTTTGCCTCCTGG + Intergenic
1029190515 7:98768575-98768597 TCACCACAACTTCTGCCTCCCGG - Intergenic
1030970073 7:116045675-116045697 CCCCCACACAGAGTCCCTCCTGG + Intronic
1031478181 7:122247946-122247968 GCCCCACACATTGACCCTACTGG + Intergenic
1031792006 7:126118287-126118309 TCCCCACACAGAGTCCCTACTGG + Intergenic
1032701197 7:134380938-134380960 TCACCACAACTTCTGCCTCCTGG + Intergenic
1033133281 7:138763551-138763573 TCACCACAGCTTCTGCCTCCCGG - Intronic
1033155176 7:138950754-138950776 TCCCACCTCATTGTGGCTCCAGG + Intronic
1033663610 7:143421170-143421192 TCACCACAACTTCTGCCTCCTGG + Intergenic
1033728409 7:144147086-144147108 TCCCCACAGATTCAGGCTCCTGG + Intergenic
1034097603 7:148424574-148424596 CCCCCACCCCTTGTGCTTCCTGG - Intergenic
1034438014 7:151072364-151072386 TCCCCGCAACTTCTGCCTCCTGG + Intronic
1034898270 7:154891533-154891555 ACCCCACAGATTTTGCGTCCTGG - Intronic
1035156308 7:156916467-156916489 TGTCCACACATTCTGGCTCCCGG + Intergenic
1035963838 8:4168052-4168074 TCCCTACAACTTCTGCCTCCTGG - Intronic
1036231425 8:7002692-7002714 TCCACACACACTGTGTCTGCTGG - Intronic
1039656139 8:39410193-39410215 TAGCCAAACATTGTGCCTCAAGG - Intergenic
1041069927 8:54118447-54118469 TCACCACAACTTCTGCCTCCCGG + Intergenic
1042020509 8:64369089-64369111 TCCCCCGACATTTTCCCTCCTGG + Intergenic
1042057964 8:64786721-64786743 TCCCCACACAGAGTCACTCCTGG - Intronic
1042230425 8:66548864-66548886 CCCACAGACATTCTGCCTCCAGG + Intergenic
1042748831 8:72135968-72135990 TCCTCCCACATTATCCCTCCAGG - Intergenic
1043241203 8:77937880-77937902 TCCCCACACAGAGTCCCTACCGG - Intergenic
1043844013 8:85143244-85143266 TCACCACCAATTCTGCCTCCTGG - Intronic
1045214144 8:100130059-100130081 TCCCCACACAGAGTCCCTACTGG - Intronic
1046229247 8:111332025-111332047 TCCCTACAACTTCTGCCTCCCGG + Intergenic
1046502723 8:115099031-115099053 TCACCACAACCTGTGCCTCCTGG - Intergenic
1047511017 8:125515590-125515612 TCACCACAACTTCTGCCTCCTGG + Intergenic
1047565387 8:126038898-126038920 TCACCACAAACTCTGCCTCCTGG + Intergenic
1047589429 8:126311399-126311421 TACTAACACATTCTGCCTCCGGG + Intergenic
1048858419 8:138703837-138703859 CCCCAACTCTTTGTGCCTCCTGG - Intronic
1049299565 8:141862409-141862431 TCCCCAAACAGAGTGGCTCCAGG + Intergenic
1049568554 8:143356709-143356731 TCACCACAACTTCTGCCTCCTGG - Intronic
1049655899 8:143797137-143797159 GCCCCTCACCTTCTGCCTCCAGG - Intronic
1050369103 9:4902343-4902365 TCCCAACCCTTTGTGCTTCCTGG + Intergenic
1050953580 9:11627529-11627551 TCCCCACACAAAGTTCCTACTGG + Intergenic
1051286618 9:15503819-15503841 TCACCACACCCTCTGCCTCCTGG + Intronic
1051447528 9:17155991-17156013 CCCCCACCCCTTGTGCTTCCAGG + Intronic
1051842299 9:21412685-21412707 TCCTCATACATTGGGACTCCAGG + Intronic
1051975406 9:22942138-22942160 CCCCCACACAGTGTCCCTACTGG - Intergenic
1052767933 9:32660474-32660496 TCCCCACACAAAGTCCCTACTGG - Intergenic
1052956478 9:34256435-34256457 TCCCCTCACCATGTCCCTCCTGG - Exonic
1055049006 9:71960985-71961007 TCACCACAACTTCTGCCTCCCGG + Intronic
1055595640 9:77862249-77862271 CCCCCACACAGAGTCCCTCCTGG - Intronic
1055628324 9:78196872-78196894 TGCCCAAACACTGTGCCTCCAGG - Intergenic
1055856672 9:80696519-80696541 TCACCACAAACTCTGCCTCCTGG - Intergenic
1057316445 9:93971858-93971880 TCCCCACACAGAGTCCCTACTGG - Intergenic
1057383650 9:94589829-94589851 ACCCCAAAGACTGTGCCTCCTGG + Intronic
1057484501 9:95471960-95471982 TCACCACAACTTCTGCCTCCTGG - Intronic
1057549571 9:96042109-96042131 TCCCTACCCAGTGTGGCTCCAGG - Intergenic
1057802856 9:98200496-98200518 TCCCCACACATTGTGCCTCCAGG - Intronic
1058922373 9:109629187-109629209 TACCCACACATTCTGAGTCCTGG + Intergenic
1059402707 9:114080646-114080668 TCCTCACACATTGTCTCTCTTGG - Intergenic
1059996189 9:119912699-119912721 TCCCCAAACTTTTTGCCACCAGG + Intergenic
1060386496 9:123234124-123234146 TCACCACAAACTCTGCCTCCCGG - Intronic
1060512222 9:124242457-124242479 TCTCCAAAGATTGCGCCTCCTGG - Intergenic
1062283937 9:135764804-135764826 TCCCCACACATCCTGCCAGCCGG + Intronic
1062297537 9:135840744-135840766 CCCCGACCCATTGTGCTTCCTGG - Intronic
1186568956 X:10694415-10694437 TACACACACATTGTGCATGCAGG - Intronic
1186797627 X:13062175-13062197 CCCCCACACAGAGTCCCTCCTGG - Intergenic
1187889145 X:23917258-23917280 TCCCCACAACCTCTGCCTCCAGG - Intronic
1188424922 X:30035776-30035798 TCACCACAACTTCTGCCTCCCGG + Intergenic
1188804472 X:34570314-34570336 TCCCCACACAGAGTCCCTACTGG - Intergenic
1190813260 X:53905846-53905868 TCACCACAACCTGTGCCTCCTGG + Intergenic
1192333976 X:70202192-70202214 CCCCCTCACATTGTGCCTTAGGG + Intronic
1192747657 X:73955697-73955719 TCACCACAAATTCTGCCTCCCGG - Intergenic
1193707857 X:84844761-84844783 TCCCCACACAGAGTCCCTACTGG - Intergenic
1195823573 X:108972905-108972927 TCCCCACACAGAGTCCCTACTGG + Intergenic
1196011957 X:110898201-110898223 TCCCCACACAGAGTGCCCACCGG - Intergenic
1197975694 X:132163581-132163603 CCCCCACACAGAGTCCCTCCTGG + Intergenic
1198169554 X:134092460-134092482 TCACCACAACTTCTGCCTCCCGG + Intergenic
1198229478 X:134675588-134675610 TCACCACAAACTCTGCCTCCTGG - Intronic
1199191017 X:144970889-144970911 TCCCCACAGCTTCCGCCTCCTGG - Intergenic
1199484884 X:148336984-148337006 TACCCCCTCATTGTGCCACCTGG - Intergenic
1200086950 X:153611639-153611661 CCCCCACACCTTGTGCCCCCAGG + Intergenic
1201250962 Y:12057233-12057255 TCCCAACCCCTTGTGCTTCCTGG - Intergenic
1201692838 Y:16788718-16788740 CCCCGACACATTGTGCTTCCTGG - Intergenic
1201947941 Y:19531933-19531955 TCACCACAAACTCTGCCTCCTGG + Intergenic