ID: 1057804227

View in Genome Browser
Species Human (GRCh38)
Location 9:98209182-98209204
Sequence GCCCTTCCCTAGATAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057804222_1057804227 11 Left 1057804222 9:98209148-98209170 CCAGCAAAAGTGCACGTTAGCAA 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1057804227 9:98209182-98209204 GCCCTTCCCTAGATAAGGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057804227 Original CRISPR GCCCTTCCCTAGATAAGGGG TGG Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902083754 1:13840395-13840417 ACCCTTGCCTACATAAGGGGAGG + Intergenic
911228269 1:95332033-95332055 TCCCTGCCCTTGATAAGTGGGGG - Intergenic
913280491 1:117180825-117180847 GCCCAGCCATAGATAAGGGCAGG + Intronic
920034826 1:203059109-203059131 TCCCTTGCCTGGATCAGGGGTGG - Intronic
920201695 1:204263452-204263474 GCCCTTCCCCAGGGAAGGGAGGG - Intronic
920677231 1:208046673-208046695 GGACTTACCTAGATAAGGAGAGG + Intronic
922186359 1:223278303-223278325 TCCCTTTCCTAGCAAAGGGGAGG + Intronic
1063895325 10:10675358-10675380 TTCCTTCCATAGATAAGCGGGGG + Intergenic
1066649436 10:37640523-37640545 GCCCCATCCTAGAGAAGGGGAGG - Intergenic
1067032322 10:42886064-42886086 GCCCCATCCTAGAGAAGGGGAGG - Intergenic
1067232812 10:44424126-44424148 GCCCTTCACTGGTTAAGGGTTGG + Intergenic
1070695175 10:78557812-78557834 ACCCTTCTCTACAAAAGGGGAGG - Intergenic
1070813780 10:79311235-79311257 GACCTGCCCGAGAGAAGGGGTGG + Intronic
1073193194 10:101666935-101666957 GCCCAGCCCTAGAAATGGGGTGG - Intronic
1077404757 11:2377943-2377965 GCCCCTCCTTAGCTGAGGGGCGG - Intronic
1079105699 11:17570943-17570965 GCCTTTCCCTGAATATGGGGAGG - Intronic
1082024867 11:47564973-47564995 GCCCTGCCCTAGGACAGGGGAGG + Intronic
1089313058 11:117572737-117572759 GCCCTTCATTAGATAAGTGGTGG + Intronic
1091915825 12:4271366-4271388 GCCTTTCCCCGGAGAAGGGGGGG + Intergenic
1096007079 12:48182484-48182506 CCCTTTCCCTATTTAAGGGGTGG - Intergenic
1096503941 12:52081286-52081308 GCCCTACCCCAGATAAGCAGGGG - Intergenic
1096839067 12:54370010-54370032 CCTCTCCCCTAGAAAAGGGGGGG - Exonic
1100476476 12:94940108-94940130 GCCCTTCCCTAGCTAAAGCAGGG + Intronic
1101513970 12:105417690-105417712 ACCCCTGCCTAGAAAAGGGGTGG - Intergenic
1102930616 12:116859387-116859409 GCCCCTCCCCAGAAAATGGGGGG + Exonic
1105929919 13:25042624-25042646 GCCCTTCCCATGGTGAGGGGTGG - Intergenic
1110569669 13:76990788-76990810 GACCTGCCCAAGATAAGAGGGGG - Exonic
1113793771 13:113045068-113045090 GCCCTTCCGTAGATGAGAGCAGG + Intronic
1113916610 13:113877656-113877678 GCCCTTCCCTAGAGAACAGAAGG - Intergenic
1114490190 14:23095598-23095620 GCCCTTCGAGAGAAAAGGGGAGG + Exonic
1122531651 14:102431997-102432019 GCCCTTGCCCAGCTCAGGGGTGG - Exonic
1125928672 15:43584214-43584236 GCCCTATCCTAGTTTAGGGGAGG - Intronic
1125941838 15:43684049-43684071 GCCCTATCCTAGTTTAGGGGAGG - Intergenic
1136489867 16:30600267-30600289 CCCCTTCTCTAGATCTGGGGAGG - Intergenic
1138641399 16:58390916-58390938 GCCATTCCATAGAAAATGGGAGG - Intronic
1141383625 16:83599022-83599044 GACCATCCCTAGATCAGGAGTGG + Intronic
1144201129 17:12943679-12943701 GGCCTTCCCTGGAGAAGGGAGGG + Intronic
1147918028 17:43900288-43900310 GTCCTCCCCTAGATAACGGAGGG - Intronic
1148244464 17:46021391-46021413 GCCCTGCCTTAGACCAGGGGAGG - Intronic
1151805418 17:76401947-76401969 GCGGTTTCCTAGAAAAGGGGCGG - Intronic
1155963893 18:32018682-32018704 GCCCTGCCCTAGACCAGGGTTGG + Exonic
1156892821 18:42209505-42209527 ACCCTTGCCTACATAAGGGGAGG + Intergenic
1157589076 18:48825265-48825287 GCCCTTCCCTTGGAAAGGGCAGG - Intronic
1157815193 18:50725005-50725027 GCCCTTCCCTTGAGCAGGGGTGG - Intronic
1158412599 18:57221358-57221380 GCCCTACCCTAAGGAAGGGGTGG - Intergenic
1164846855 19:31439721-31439743 GCCCTTCCCCAGCTAGGGGCTGG - Intergenic
1166668443 19:44695568-44695590 GCCTCGCCCAAGATAAGGGGAGG + Intergenic
1168282583 19:55313322-55313344 GCCCTTCCCTGGGTCAGGGAAGG - Intronic
925942758 2:8836507-8836529 CCCATTCCCTAGATCTGGGGTGG + Intronic
926584889 2:14675071-14675093 GCTCTTCCCTGGAGCAGGGGCGG - Intergenic
927043803 2:19256508-19256530 GGACTTCCTTAGAAAAGGGGTGG + Intergenic
929666530 2:43838328-43838350 GCCCTTCCCTGGGCAGGGGGAGG + Intronic
929990592 2:46782847-46782869 GACCTGCCCTTGATAAGCGGAGG - Intergenic
930063881 2:47312811-47312833 CCCCTTCCCTAAATCAGGGGTGG + Intergenic
935044784 2:99471113-99471135 AACCTTGCCTAGATAAGGGGTGG - Intronic
937368869 2:121284562-121284584 GCCCTTCCTTGGACGAGGGGCGG - Intronic
942757919 2:179363918-179363940 GTCTTTCCCTAGCTCAGGGGTGG - Intergenic
949075623 2:242055671-242055693 GCCATTCCCTAGGTAACGGGGGG + Intergenic
1169266033 20:4167862-4167884 GCCCCTCCCTGGTTGAGGGGTGG + Intronic
1171087752 20:22253509-22253531 GCACTTACCTTGATTAGGGGAGG - Intergenic
1173505751 20:43585807-43585829 GCCTGGCCCTAGCTAAGGGGAGG - Intronic
1176936638 21:14875356-14875378 GCCCCACCCAAGATAAGTGGAGG - Intergenic
1182476992 22:30581779-30581801 GCGCTGCCCTAGGGAAGGGGTGG + Intronic
1183007889 22:34918550-34918572 GCCATTGCCTAGAGAAGGGCTGG - Intergenic
1184593769 22:45502591-45502613 GCCCTCCCCTCGAGAGGGGGTGG + Intronic
950239028 3:11351320-11351342 GGCCTGACCTAGATGAGGGGTGG + Intronic
950580451 3:13858523-13858545 GCCCTTCCCCACCTCAGGGGTGG - Intronic
953148083 3:40297501-40297523 GCTCTACCTTAGATAAGGGATGG - Intergenic
957046234 3:75377292-75377314 GCCATTCACTAGAAGAGGGGGGG - Intergenic
963700460 3:148619168-148619190 GCCCTTCCCTCAATAAGGGAGGG + Intergenic
975672853 4:76798974-76798996 CCCTTGCCCTAGATAGGGGGAGG + Intergenic
978118337 4:105049432-105049454 CCCCTTCCCTTGGTTAGGGGAGG - Intergenic
978175016 4:105719261-105719283 GCCTTTCCCTTAGTAAGGGGAGG - Exonic
979789555 4:124761624-124761646 GCCTTTCCATAGATTAGGAGAGG + Intergenic
990154767 5:52863459-52863481 GGCCTTCCCTAGGTTGGGGGTGG + Intronic
990644887 5:57832968-57832990 GCCCTTCCCTTGATGAGGGCTGG + Intergenic
991181482 5:63756391-63756413 GCCCTTCCCTACAAAATGAGGGG - Intergenic
991242268 5:64473960-64473982 GGGCTTCCCTTGATTAGGGGAGG - Intergenic
995269155 5:110201474-110201496 TCCCTTCTATAGAGAAGGGGAGG - Intergenic
997422473 5:133780139-133780161 GTCCTTCCCTAGATAGCAGGAGG - Intergenic
997622442 5:135307670-135307692 GCCTGCCCCTCGATAAGGGGAGG + Intronic
998139179 5:139690335-139690357 GCCCAGCCCTGGATGAGGGGTGG - Intergenic
1000048576 5:157542214-157542236 ATCCTTCCCTAGAAAAGGGAGGG - Intronic
1002853311 6:1015872-1015894 GCCCTTTCCTGTATAAGGGGTGG + Intergenic
1003032915 6:2618295-2618317 TCCATTCCCAATATAAGGGGTGG + Intergenic
1003891306 6:10566053-10566075 GCCCTTCCCCAGATAACTTGCGG + Intronic
1003905516 6:10695568-10695590 GACGTTGCCTACATAAGGGGTGG + Intronic
1004759877 6:18654872-18654894 GCCCTGACCTAGATCAGAGGTGG + Intergenic
1008993552 6:57632452-57632474 GCTCATCCCTAGATATGGAGTGG - Intronic
1009182158 6:60531538-60531560 GCTCATCCCTAGATATGGAGTGG - Intergenic
1010992060 6:82490293-82490315 TCCCTTCCCTGCATAAGGCGTGG - Intergenic
1012255649 6:97028269-97028291 GCCCTTCCCTACTTAAGGTGTGG - Intronic
1014811757 6:125894412-125894434 CCCCTTCCCTAGAAGAGGTGTGG + Intronic
1020066858 7:5195024-5195046 GTCCTTCCCTAGAGAAGGACAGG + Intronic
1024984669 7:55184436-55184458 GGCCTGACCTAGATAAGTGGAGG + Intronic
1026475573 7:70732357-70732379 GCACTTCCCTAGAGAAGAGGGGG + Intronic
1026664993 7:72334528-72334550 GCCCTTTCCTCTGTAAGGGGAGG - Intronic
1026881191 7:73907824-73907846 GCCCTTCTCTCAATGAGGGGAGG - Intergenic
1027523710 7:79241416-79241438 GCCCTTCCCCAGAATAAGGGAGG - Intronic
1033576030 7:142685818-142685840 TCCCTTCCCTAGTTAAGAGTGGG + Intergenic
1034498112 7:151433885-151433907 GCCCTTCCCCAGGTGAGGGTAGG + Intronic
1040981929 8:53252718-53252740 GCCCTTCCCTCCATCAGCGGAGG + Intergenic
1045788557 8:105955111-105955133 TCCCTTTCCTAGCCAAGGGGAGG + Intergenic
1048465853 8:134664239-134664261 GCACTTCCCTGGCTGAGGGGAGG - Intronic
1052889654 9:33686601-33686623 CCCCTTCCCTAGTTAAGAGGGGG + Intergenic
1055010292 9:71558315-71558337 TCAGTTCCCTAGATAAGGAGAGG + Intergenic
1055796858 9:79983792-79983814 CCCCTTCCCTGGAGTAGGGGTGG - Intergenic
1056949151 9:91028298-91028320 GCCCTTCCCAAGAGGTGGGGAGG - Intergenic
1057804227 9:98209182-98209204 GCCCTTCCCTAGATAAGGGGTGG + Intronic
1062380294 9:136283826-136283848 GCCCAGCCCTTGAGAAGGGGTGG - Intronic
1191138391 X:57090901-57090923 TCCCTTCCCTAGCCAAGGGAAGG - Intergenic
1195554094 X:106201624-106201646 GCCCCTGCCTGGATCAGGGGAGG - Intronic
1195564961 X:106330178-106330200 GCTCTGCCCAATATAAGGGGAGG + Intergenic
1196031198 X:111096797-111096819 GCAGTTCCCTAGAAAAGGGGAGG + Intronic