ID: 1057807699

View in Genome Browser
Species Human (GRCh38)
Location 9:98232288-98232310
Sequence CCTTTGGAGCAGTCAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057807699 Original CRISPR CCTTTGGAGCAGTCAGTGCC TGG (reversed) Intronic
901242201 1:7702052-7702074 CCTGTGGTGCAGTGAGTGGCAGG + Intronic
901780147 1:11588797-11588819 CCTGTGGAACTGTCAGTCCCAGG - Intergenic
904202347 1:28829046-28829068 CCTAGAGAGAAGTCAGTGCCTGG - Intronic
905768793 1:40624315-40624337 CCTCTAGAGCAGTCACTGTCAGG - Exonic
907490783 1:54807538-54807560 TCTTTGGAGCTGTAAGTCCCAGG - Exonic
910686071 1:89917802-89917824 CCTTGGAAGCGGTCAGTGCGAGG + Intronic
912258825 1:108088208-108088230 CCTTTGCAGCACACAGCGCCTGG + Intergenic
912506898 1:110162656-110162678 CTTTTAGAGCAGGCAGGGCCTGG - Intronic
915358464 1:155271033-155271055 TCTTTGGAGCAGCCAGTCCTTGG - Intronic
915898239 1:159827717-159827739 GCTTTGGAGCTCTCAGGGCCAGG - Intronic
921379443 1:214509159-214509181 GCTAGGGAGAAGTCAGTGCCTGG - Intronic
921387520 1:214586024-214586046 CATTTGTAGCAGTAAGTACCTGG + Intergenic
923086791 1:230708476-230708498 CCCTGTGACCAGTCAGTGCCAGG + Intronic
923203916 1:231739623-231739645 CCCTTGAAGAACTCAGTGCCTGG - Intronic
1062852194 10:753249-753271 CCCTTGGGGCAGCAAGTGCCTGG - Intergenic
1063129026 10:3161635-3161657 CCTCTGGAGCAGGGAGGGCCCGG + Intronic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065067153 10:21981686-21981708 CCTTTTCAGCAGACGGTGCCAGG + Intronic
1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG + Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067478735 10:46582198-46582220 CCTCTGGAGCAGGCAGGGTCTGG + Intronic
1067749781 10:48963197-48963219 CCTGTGAAACAGCCAGTGCCTGG + Intronic
1069185367 10:65415717-65415739 GCTTTGGATGAGTCAGTGACTGG + Intergenic
1069705006 10:70453052-70453074 TCTTTGGTACAGTCAGTGCCTGG - Intergenic
1070662844 10:78319953-78319975 CCCTTGGAGCAGTCAGATCTGGG + Intergenic
1070803188 10:79255317-79255339 CCTGAGGGGCAGGCAGTGCCTGG + Intronic
1072631918 10:97152153-97152175 ACCTTGGCACAGTCAGTGCCCGG - Intronic
1075066706 10:119293740-119293762 CCGAGGCAGCAGTCAGTGCCAGG + Intronic
1075212537 10:120503187-120503209 CATTTGGGGCTGTGAGTGCCAGG - Intronic
1075581937 10:123625479-123625501 CAGTTGGAGCAGAAAGTGCCAGG + Intergenic
1076393573 10:130121785-130121807 CCTTTGGAGGACCAAGTGCCAGG - Intergenic
1076722761 10:132399948-132399970 CCTTTCCAGCAGTCTGTGTCTGG - Intronic
1077164402 11:1128728-1128750 CCTCTGGAGCCCTCAGGGCCTGG - Intergenic
1081661570 11:44891719-44891741 GCTTTGGAGCAGCCAGAGCAGGG + Intronic
1081806711 11:45894830-45894852 CCTTTGGAGCAGCCAGGGGGTGG + Intronic
1083732313 11:64659254-64659276 CCTTTGGAGCTTTCAGAGCAGGG - Intronic
1085470091 11:76752349-76752371 GCACTGGAGCAGTCAGGGCCTGG + Intergenic
1090334833 11:125955226-125955248 CCTTTGGATAGGTCAGGGCCTGG - Intergenic
1091224591 11:133949966-133949988 CCTTTGGAGCAGTTATGGCGGGG + Intronic
1091236931 11:134028452-134028474 CCTAAGGAGCAGACAGTGTCGGG - Intergenic
1091791962 12:3277065-3277087 CCTTTCCAGCAAGCAGTGCCCGG + Intronic
1094039964 12:26112239-26112261 TCTTTGGATCACACAGTGCCTGG + Intergenic
1095179035 12:39125816-39125838 CCTTTGAAACAGCCAGTTCCTGG - Intergenic
1095259694 12:40083729-40083751 CCTTTGGAGGGGTGAGTCCCAGG - Intronic
1096204503 12:49709385-49709407 CATTTTGAGCAATTAGTGCCAGG - Intronic
1097145473 12:56936646-56936668 TCTTTGTAGCACTCAGTGACCGG - Intergenic
1098482193 12:70976762-70976784 CAGTTGGAGTAGACAGTGCCTGG + Intergenic
1099301208 12:80896810-80896832 CACTTTGAGCAGTCAATGCCAGG - Intronic
1102729196 12:115092946-115092968 CCCTTGGAGCAGTCAGGACTTGG - Intergenic
1103131388 12:118471653-118471675 CCTTTGTATCAGTCAGTTTCTGG - Intergenic
1103272852 12:119688031-119688053 TCTTCGGAGCTGTCAGCGCCCGG - Exonic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1113452348 13:110420140-110420162 CCCTTGGAGCAGTAAGGGCCTGG + Intronic
1113633854 13:111906601-111906623 AGTTGGGAGCAGGCAGTGCCTGG + Intergenic
1113768749 13:112895653-112895675 CCTGTGGAGCCCTCAGTCCCAGG + Intronic
1113961476 13:114128621-114128643 CCTGTGGGGCAGTGAGGGCCAGG - Intronic
1117529804 14:56649053-56649075 CCATTGGAGCCTGCAGTGCCTGG + Exonic
1118298769 14:64595350-64595372 TCTCTAGAGCAGTCTGTGCCTGG + Intergenic
1121463720 14:94101029-94101051 TCATTGGAGCAGTCACAGCCCGG + Intronic
1127029672 15:54848150-54848172 CCTTCAGAGAAGTCACTGCCTGG - Intergenic
1127292486 15:57582803-57582825 CATCTGCAACAGTCAGTGCCTGG - Intergenic
1127646165 15:60961616-60961638 CCTTTGGCCCATTCAGAGCCGGG - Intronic
1129205060 15:74032638-74032660 GCTGTGGTACAGTCAGTGCCCGG + Exonic
1129503736 15:76063674-76063696 CCTTTGGAGCATTCATTCCATGG - Intronic
1129603881 15:77015426-77015448 CCCTTGGTGCAGTGTGTGCCAGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132557347 16:578495-578517 CCTGTGGATCAGTGAGTGCAGGG + Exonic
1137352953 16:47730179-47730201 CCTTGAGAGCAGTCACTGCGTGG + Intergenic
1137391815 16:48087735-48087757 CCTTGGGAGGAGCCAGGGCCCGG - Intronic
1138656069 16:58492205-58492227 CCTTTGGAGACTCCAGTGCCTGG + Intronic
1138839100 16:60476463-60476485 CCTTTGGACCACTCTTTGCCTGG - Intergenic
1139374301 16:66487260-66487282 CCTAGGGAGAAGTCAGTGCCTGG - Intronic
1140137832 16:72223511-72223533 CCTTATGACCAGTCAGTGGCTGG + Intergenic
1142853277 17:2715623-2715645 CCTGTGGAGCCCTCAGGGCCTGG - Intergenic
1143025980 17:3942226-3942248 CACTTGGAAAAGTCAGTGCCTGG - Intronic
1143118768 17:4594879-4594901 CCTTTGCAGGTGTCAATGCCTGG - Intronic
1144632757 17:16882387-16882409 CCTTTGGGGCAGTCAATGGTGGG - Intergenic
1145208443 17:20996670-20996692 CCTCTGGGGCAGTCAGTGGTGGG + Intergenic
1152568127 17:81109230-81109252 CCTTTTGAGCAGAAACTGCCAGG + Intronic
1152864349 17:82713314-82713336 CGTCTGGAGCAGTCACTGCGTGG - Intergenic
1153961954 18:10147597-10147619 CCTTTGCTGCAGTGAGTGTCCGG + Intergenic
1154175834 18:12086946-12086968 CCCATGGAGCGGCCAGTGCCAGG - Intergenic
1157810021 18:50688301-50688323 CTTTTGGGGCCGTCTGTGCCTGG - Intronic
1161445939 19:4319166-4319188 ACTCTGGACCAGACAGTGCCTGG + Intronic
1161651238 19:5486628-5486650 CTGATGGAGCAGTCACTGCCTGG - Intergenic
1164290930 19:23868019-23868041 CATTTAGAGGAGTCAGTTCCCGG + Intergenic
1166774768 19:45305701-45305723 CTTTTGGAGAACTCAGTCCCAGG - Intergenic
1166917635 19:46206349-46206371 CCTGGAGAGCAGCCAGTGCCAGG - Intergenic
1167159274 19:47756654-47756676 ACAATGGAGCAATCAGTGCCCGG - Intronic
925894950 2:8463978-8464000 CATTGGAAGCAGTGAGTGCCTGG + Intergenic
926092521 2:10060029-10060051 CCTTTGCAGGAGGCAGTCCCGGG + Intronic
927961269 2:27241963-27241985 CCTTTGCAGCAGCCATGGCCCGG + Exonic
929594584 2:43168325-43168347 GCTGTGGAGCAGCAAGTGCCAGG - Intergenic
931837972 2:66119307-66119329 ACTTTTGAGCAATGAGTGCCAGG + Intergenic
932286514 2:70537926-70537948 GCTATGGAGAAGTCAATGCCTGG + Intronic
932396357 2:71451546-71451568 CCTTTGGAGAATACAGTGCAAGG - Intergenic
933200379 2:79441066-79441088 CCTTTGTAACAGTCAGTTCCTGG - Intronic
935313002 2:101804037-101804059 CCCTTGGAGCAGAGAGAGCCTGG - Intronic
936877909 2:117214594-117214616 TCTTTGGGGATGTCAGTGCCTGG - Intergenic
937232054 2:120403961-120403983 CATAGGGAGGAGTCAGTGCCTGG - Intergenic
937479355 2:122242618-122242640 CCTTTGGAAGAGGCATTGCCTGG - Intergenic
938555133 2:132417061-132417083 ATTTGGGAGCAGTCACTGCCCGG - Exonic
938582486 2:132659612-132659634 CCCTTGCAGCAGTCAGTGACAGG + Intronic
941008242 2:160269627-160269649 CCTGTGAGGCAGGCAGTGCCTGG + Intronic
943754322 2:191542163-191542185 CCTTTGCAGCAGTAAGTGCAGGG + Intergenic
945740007 2:213647789-213647811 CCTTCAGAGAAGACAGTGCCTGG - Intronic
946027010 2:216678068-216678090 TTTTTGGAGCAGTCTGAGCCTGG + Intronic
946112102 2:217429037-217429059 GCTTTGGAGAAGCCAGAGCCTGG - Intronic
946518916 2:220444969-220444991 CCTTTGGTCCAATCAGTGCCTGG + Intergenic
947529469 2:230899568-230899590 CCTTTGGATCACTCAGTGACAGG + Intergenic
948461779 2:238133107-238133129 CCATTGGGGCAGGCAGGGCCGGG + Exonic
948950021 2:241243401-241243423 CCTTTAGGTCAGTCAGGGCCGGG + Intronic
1170590549 20:17768060-17768082 CCTCTGGAGGTGTCAGTGCAGGG + Intergenic
1172913021 20:38424222-38424244 CTTTTGGAGCAGGCCATGCCTGG + Intergenic
1175961478 20:62639002-62639024 CCTTTGGAGCAGGGTGTGGCTGG - Intergenic
1176183943 20:63767786-63767808 CCCTGGGGGCAGCCAGTGCCAGG - Intronic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1181422513 22:22811681-22811703 CCTATGGGGCAGTAAGTGCTTGG - Intronic
1182708964 22:32308454-32308476 CCTGTGGGGGAGTCAGTGTCAGG + Intergenic
1183469914 22:37999677-37999699 GCTTTGGGGCAGTCAGAGCAGGG + Intronic
1184082953 22:42238040-42238062 AATTAGGAGAAGTCAGTGCCTGG - Intronic
1184129032 22:42506372-42506394 CCTGTGCAGCAGCCAGTGCCTGG - Intergenic
1184138979 22:42566686-42566708 CCTGTGCAGCAGCCAGTGCCTGG - Intronic
1184975426 22:48058184-48058206 TTTTGGGAGCAGTCACTGCCTGG + Intergenic
1185212341 22:49577387-49577409 CCTTTGGAGCAGGCAGGCACAGG - Intronic
949949351 3:9216427-9216449 CCTGTGGAGCAGCCACAGCCCGG + Intronic
950224907 3:11225504-11225526 TCTTTGGAGCACTCAGTGACGGG + Intronic
953413810 3:42704240-42704262 CCTGCAGGGCAGTCAGTGCCAGG - Intronic
953742898 3:45552368-45552390 CCCTGGGAGCCGTCAGTCCCAGG - Intergenic
954584046 3:51718979-51719001 CATTTGGAGGATCCAGTGCCAGG - Intergenic
954791394 3:53135944-53135966 CCTTGGGAGAATTCGGTGCCAGG + Intergenic
960338500 3:116446414-116446436 CATTTTGAGAAGTAAGTGCCAGG - Intronic
960458110 3:117898981-117899003 CCTTTCAGGCAGTCAGTGCTAGG - Intergenic
960760671 3:121071418-121071440 CCTCTGGTGCAGTCAGAGCAGGG + Intronic
961662402 3:128476543-128476565 TTTTTGGAGCACACAGTGCCAGG - Intergenic
969090998 4:4693959-4693981 CTTTAGGAGCAATCAATGCCTGG - Intergenic
969781172 4:9405551-9405573 CTTTTGGAGGACACAGTGCCTGG - Intergenic
970521413 4:16888125-16888147 CCCTTGGAGAAGTCTGTGCTGGG + Intronic
971185450 4:24371497-24371519 TCTTTGGAGAAGACAGTGGCTGG - Intergenic
974507619 4:62797212-62797234 CCTTTGGTGATGTCAGTGCTGGG + Intergenic
976733441 4:88286479-88286501 CCTTGGAAGAAGGCAGTGCCTGG - Intergenic
981480225 4:145230767-145230789 CTTTTGGAGCGGTCACTGGCAGG + Intergenic
982546322 4:156737511-156737533 CCTTTATAGCAGTCAGTCACTGG + Intergenic
985639252 5:1055956-1055978 CCTTGTGGGCAGGCAGTGCCTGG - Intronic
986245937 5:6006705-6006727 ACTCTATAGCAGTCAGTGCCTGG - Intergenic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
987761655 5:22171385-22171407 ACTATGGAGCAGTCAGTCACTGG - Intronic
991619338 5:68529365-68529387 CCTTAGCAGCAGTTAGTGCTTGG + Intergenic
991896443 5:71404825-71404847 ACTATGGAGCAGTCAGTCACTGG - Intergenic
992226961 5:74628141-74628163 ACTTTCCAGCAGTCAGTCCCTGG - Exonic
999737828 5:154526086-154526108 CCTTTGCAGTAGACAGTGCATGG + Intergenic
1000199805 5:158997169-158997191 CCTTTGGAGCAGTGAATTCCTGG + Intronic
1006406489 6:33848677-33848699 CCTTTGGAGCTGACAGGGGCAGG + Intergenic
1007418339 6:41705150-41705172 CCTTTGGGACAGTGTGTGCCTGG + Intronic
1012034594 6:94117219-94117241 CCTTAGAAGCAATCTGTGCCTGG + Intergenic
1012082157 6:94773619-94773641 CATCTGGAGCAGTTAGGGCCAGG + Intergenic
1013968032 6:115979271-115979293 CCTTTGGACTAGTCAGGGTCAGG - Intronic
1019407541 7:891572-891594 CCCCTGGAGCAGGCAGCGCCCGG - Intronic
1021635089 7:22684101-22684123 CCTGTGGTGCAGTGAGTGCTAGG + Intergenic
1022819187 7:33942341-33942363 CCTTGTGAGGATTCAGTGCCTGG - Intronic
1023157761 7:37268244-37268266 CCTTTGGAGCAGTCAGGATTTGG - Intronic
1024630221 7:51241009-51241031 CCTTTAAAGCACTCACTGCCTGG - Intronic
1026112014 7:67465923-67465945 CCTTTGGAACAGTAAAAGCCAGG - Intergenic
1027829744 7:83162659-83162681 CCAGGGGAGCAGTCAGAGCCGGG + Exonic
1032303443 7:130710652-130710674 ATTTTGGAGAAGTCAGTTCCAGG - Intergenic
1034792794 7:153987043-153987065 CTTTCTGAGCAGTCTGTGCCTGG - Intronic
1035017152 7:155776626-155776648 CTGTTGCAGCAGTCAGTCCCAGG + Exonic
1035334822 7:158121120-158121142 CCTTTGGAGCAGTCACCACCAGG - Intronic
1039888640 8:41669906-41669928 CCTTTGAAGGAGACCGTGCCTGG - Intronic
1040589598 8:48778278-48778300 CCTTTGTGGCAGTCAATGCTGGG - Intergenic
1044843690 8:96359868-96359890 ACCTTGGAGAAGACAGTGCCAGG - Intergenic
1046264901 8:111817866-111817888 ACATTTGAGCAGTTAGTGCCTGG - Intergenic
1049594555 8:143477421-143477443 CCTCTGGCCCAGACAGTGCCCGG - Intronic
1049658526 8:143809447-143809469 GTTTTGGTGCAGGCAGTGCCTGG - Intronic
1050363419 9:4852684-4852706 CCTGAGGAGCTGTCAGTGCTGGG + Intronic
1057807699 9:98232288-98232310 CCTTTGGAGCAGTCAGTGCCTGG - Intronic
1062618078 9:137407098-137407120 CCTGCGGAGCAGCCAGTCCCGGG + Intronic
1186220793 X:7347176-7347198 CCTTTGGAGATGTCAGTTGCTGG + Intronic
1186362343 X:8855510-8855532 CAGTTGGAGCAGTAAGTTCCTGG - Intergenic
1188976872 X:36686240-36686262 GCTATGGAGCAGTAAGTGACTGG + Intergenic
1189619658 X:42822022-42822044 CCTCTTGCGCAGTCAGTTCCTGG + Intergenic
1190302908 X:49066930-49066952 CCCTTGGAGCTAACAGTGCCAGG + Intronic
1192168058 X:68838382-68838404 CCTGCCGAGCAGTCAGAGCCTGG + Intronic
1195001621 X:100648404-100648426 CCTTTAGATCAATCAGTGCTTGG - Intronic
1199268680 X:145857565-145857587 CCTTTGGGTCAGTCATTACCAGG + Intergenic
1200013971 X:153144909-153144931 CCTATGAAACAGTCTGTGCCTGG - Intergenic
1200025629 X:153255044-153255066 CCTATGAAACAGTCTGTGCCTGG + Intergenic