ID: 1057807897

View in Genome Browser
Species Human (GRCh38)
Location 9:98233673-98233695
Sequence CATGTAGGGTGCCTGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057807897_1057807901 -5 Left 1057807897 9:98233673-98233695 CCAGACTCCAGGCACCCTACATG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1057807901 9:98233691-98233713 ACATGATGCCTCCCCATGCATGG 0: 1
1: 0
2: 1
3: 15
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057807897 Original CRISPR CATGTAGGGTGCCTGGAGTC TGG (reversed) Intronic
900742768 1:4340670-4340692 GATGTAGGAGGCCTGGAGTGCGG + Intergenic
902114249 1:14107859-14107881 CAGGTAGGTTTCTTGGAGTCAGG - Intergenic
902218709 1:14950893-14950915 CCTGCAGGGTGTCTTGAGTCTGG + Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
905695509 1:39970580-39970602 CCTGTGGGGTCCCTGGAGACTGG + Intergenic
906194439 1:43921044-43921066 CACGTAGGATGCTTGGTGTCAGG - Intronic
906580222 1:46929951-46929973 CAGGTAGGGAGCCTGGAGAAAGG + Exonic
906588342 1:47000729-47000751 CAGGTAGGGAGCCTGGAGAAAGG + Intergenic
907673904 1:56501072-56501094 CATGCAGTGAGCCTGGAGGCAGG + Intronic
914754924 1:150557196-150557218 GCTGGAGGGTGCCTGGGGTCCGG - Exonic
917143064 1:171857169-171857191 ATTGCAGTGTGCCTGGAGTCAGG + Intronic
918340319 1:183563236-183563258 CATGAAGGATGCCTGGGGCCAGG - Exonic
921432332 1:215079992-215080014 CATGTAGGGTGCTTGGGGGTTGG - Intronic
1064922135 10:20531116-20531138 CAGTTAGGCTGCCTGGGGTCAGG + Intergenic
1067382490 10:45787695-45787717 CACCTGGTGTGCCTGGAGTCAGG - Intronic
1067890188 10:50128243-50128265 CACCTGGTGTGCCTGGAGTCAGG - Intronic
1069743914 10:70702854-70702876 CAGGGAGGCTGCCTGGTGTCTGG + Intronic
1069823189 10:71239970-71239992 AGTGTGGGGTGCCTGGAGGCAGG + Intronic
1070946492 10:80396088-80396110 CAGGTAAGGTGCCTGGAGGCAGG + Intergenic
1072427256 10:95340166-95340188 CATGTAGAGTGTTTGGATTCTGG + Intronic
1075060065 10:119250485-119250507 GCTGTAGGATGCCTGGAGCCTGG - Intronic
1076533782 10:131162682-131162704 CGTGGAGGGTGTCTGGAGTGTGG + Intronic
1080830514 11:35889573-35889595 CTTGCAGGGTGATTGGAGTCGGG - Intergenic
1081584021 11:44371908-44371930 CATGGAGGGGGCCAGGAGACTGG - Intergenic
1081676781 11:44974582-44974604 GCTGGAGGCTGCCTGGAGTCTGG - Intergenic
1083055100 11:59811778-59811800 CTTAAAGGGTGCCTGGAGGCCGG + Intergenic
1083475269 11:62911132-62911154 CCTGTAGCGTGCCTGGAGGAAGG - Exonic
1083766049 11:64842150-64842172 GATGGAGGCTGCCTAGAGTCTGG - Intronic
1084791365 11:71477189-71477211 CTTGTCGTGTGCCTGGAGTCAGG + Intronic
1087756969 11:102064496-102064518 CATGAAGGATGCCTGGAGCCAGG - Intronic
1091037618 11:132247664-132247686 CATGGAGGGATCCTGGATTCGGG + Intronic
1094825256 12:34264616-34264638 CAAGCAGGGTGCCGGGAGGCAGG - Intergenic
1096211656 12:49770900-49770922 CTTGTGGAGTGCCTGGAGTGAGG + Intergenic
1099367774 12:81790555-81790577 AATGTAGGAGGCCTTGAGTCGGG + Intergenic
1103512865 12:121487341-121487363 CATTTATGGAGTCTGGAGTCTGG - Intronic
1103688232 12:122749958-122749980 CAAGTAGAGTGCCTGGATGCTGG - Intergenic
1107400618 13:40065487-40065509 CATGGAGGGTGGATGGAGTGAGG - Intergenic
1110495231 13:76160718-76160740 TATGCAGGGATCCTGGAGTCTGG - Intergenic
1118980116 14:70709565-70709587 CATCTAGGGTGCCTGCAATGGGG - Intergenic
1119231308 14:72981955-72981977 CTTGTACGGTGCCTGCAGTGGGG - Intronic
1119817055 14:77579002-77579024 TCTGTAGTGTGCCTGGAGCCAGG - Exonic
1120837106 14:89050107-89050129 CAGGTAGGTTGCCTGAGGTCAGG + Intergenic
1121009492 14:90511668-90511690 CCTCTAGGGTGCCTGGATTCTGG - Intergenic
1121299843 14:92861616-92861638 CTTGCAGGGTGCCTGGCTTCTGG + Intergenic
1122103991 14:99437283-99437305 CATGCAGTGGGCCTGGAGTGTGG - Intronic
1122693165 14:103541065-103541087 CATGTAGGCTGAATGCAGTCCGG + Intergenic
1124830223 15:33141602-33141624 AATGTAGGGAGCATGGAGACTGG + Intronic
1125357738 15:38834194-38834216 CATGTAGGGTGAGTGGGGACAGG - Intergenic
1132648592 16:1010318-1010340 CAGGTGGGGAGCCTGGTGTCTGG + Intergenic
1132724171 16:1331746-1331768 TAGGTAGGGAGACTGGAGTCCGG - Intergenic
1133831452 16:9327031-9327053 TATGTATGGTGCTTGGGGTCGGG + Intergenic
1139643372 16:68309854-68309876 CTTGCAAGGTGCCTGGAGCCCGG - Intronic
1140196924 16:72862774-72862796 CTTGTAGGATCCCTGCAGTCGGG - Intronic
1141951540 16:87343061-87343083 CATCTTGGGTGCCTGCAGTGGGG - Intronic
1143439616 17:6959380-6959402 TATGTGGGAGGCCTGGAGTCTGG + Intronic
1143568307 17:7738657-7738679 CAGGTAGGGTTCCTGGGATCAGG - Intronic
1145975502 17:28981668-28981690 CAAGGAGGGACCCTGGAGTCCGG - Exonic
1146479583 17:33194068-33194090 CATGGATGGTCCCTGGAGGCTGG - Intronic
1151163888 17:72187938-72187960 CATGTTGGGTGCCTGGGTACTGG + Intergenic
1153080501 18:1218091-1218113 CATGTAGGGACCCTGGTGTATGG - Intergenic
1158892826 18:61889049-61889071 CATTCAGGGTGCCTGGGGTTGGG - Intronic
1160072938 18:75644229-75644251 AATGTATGGTGCCTTGAATCGGG + Intergenic
1161660662 19:5544008-5544030 AATGAAGGAAGCCTGGAGTCAGG + Intergenic
1163369359 19:16893426-16893448 CTTGTAGGGTGCCAGGGGTGGGG + Intronic
1163460305 19:17433448-17433470 CATATCAGGTGCCTGGAGTCTGG + Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165363906 19:35352337-35352359 CATCACGGGTGCCTGGAGTGTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
925367708 2:3322294-3322316 GATGGTGGGTGCCTGGAGTTTGG + Intronic
925367908 2:3323735-3323757 CATAGAGGTTGCCTGGAGGCTGG - Intronic
927701836 2:25274064-25274086 GATGCCAGGTGCCTGGAGTCTGG - Intronic
928440337 2:31286890-31286912 CATGTGGATTGCCTGAAGTCAGG - Intergenic
930016585 2:46974906-46974928 CATGGGGAGGGCCTGGAGTCAGG + Intronic
930473048 2:51845225-51845247 TATGTAGGGAGCATGGGGTCTGG - Intergenic
931434370 2:62234406-62234428 CATGTAAGGTGCTTGGAGCCTGG + Intergenic
937164062 2:119795343-119795365 CATGAACGGTGGCAGGAGTCAGG - Intronic
937227009 2:120375826-120375848 CAGGTCAGGTGCCTGGAGGCCGG + Intergenic
940427391 2:153545802-153545824 CATGTTGGGTGCCTGGATTGGGG - Intergenic
940796823 2:158089237-158089259 CATGTAGGTTGCCAGGAGAGTGG + Intronic
940854294 2:158717718-158717740 CATGTAGGGAACATGGTGTCCGG - Intergenic
941549813 2:166901079-166901101 CATGTTGTTTGCCTGGAGTATGG + Intronic
942374568 2:175323922-175323944 CAGGTAGGATGACTGGAATCAGG - Intergenic
942450735 2:176106821-176106843 CTTCTAGGGAGCCTGGAGCCGGG + Intronic
943650959 2:190457135-190457157 CATGTAGGGAGCTTGGAGTGTGG + Intronic
946348351 2:219129615-219129637 CATGAAGGAGGCCTGGAGTGGGG - Intronic
1169025983 20:2371944-2371966 CATCTAGGGAGCCTGGAATGGGG + Intergenic
1172854284 20:37989564-37989586 CTTGCAGGGTTCCTGGAGGCAGG - Intronic
1175202758 20:57289468-57289490 CCTCAAGGGTGCCTGGAGACTGG + Intergenic
1178532228 21:33385396-33385418 CCTGTGGAGTGCCTGGAGTAGGG + Intergenic
1178935520 21:36858665-36858687 GATGGAGGGTGCCTGCAGTGAGG + Intronic
1179909025 21:44438307-44438329 CATGCGGGGTGCGTGGAGTTGGG + Intronic
1180024360 21:45150953-45150975 CAGGGAGGGTGCCATGAGTCAGG + Intronic
1181795335 22:25304516-25304538 CATTTAGGGTCTCTGTAGTCAGG + Intergenic
1181835876 22:25608034-25608056 CATTTAGGGTCTCTGTAGTCAGG + Intronic
1184761418 22:46546958-46546980 CATGTAGAGTGGCTGGACACCGG - Intergenic
1185402662 22:50626906-50626928 CATGTAGCGGGCCTCTAGTCCGG + Exonic
955284266 3:57623822-57623844 CATGTAGGATCCATGAAGTCCGG + Intergenic
957491235 3:80930108-80930130 CATGTAGGGTACCTTTTGTCAGG - Intergenic
960816565 3:121679585-121679607 CATGTTGTTTGCCTGGAGTATGG - Intronic
960914191 3:122680580-122680602 CAGGTAGGGGGCCCGGAGTTAGG + Intergenic
964127019 3:153244611-153244633 CATGTACAGTGGCTGGAGTTTGG + Intergenic
966705803 3:182912091-182912113 CATGTAGGAGCCCTGGAGTCTGG + Intronic
969043125 4:4316667-4316689 GCTGTAGGGAGCCTGGATTCAGG + Intronic
969182538 4:5453367-5453389 CAAGTTGGGTGCTTGGATTCTGG + Intronic
969766180 4:9230878-9230900 CAACTCGGGGGCCTGGAGTCAGG - Intergenic
974199276 4:58617959-58617981 AATTTAGGTGGCCTGGAGTCTGG - Intergenic
984325171 4:178241943-178241965 CATGAAGGGTGGCAGGAGACAGG + Intergenic
987039521 5:14048707-14048729 TATGTAGGGTGCCTGGGTTGAGG - Intergenic
988105343 5:26739996-26740018 CATGTAGTGGGCCTGGAGGAAGG + Intergenic
990526623 5:56634405-56634427 AATGTAGAGTGCCTTGGGTCAGG - Intergenic
992539079 5:77744048-77744070 CATTTAGGGTCCGTGGAGTTGGG - Intronic
995964601 5:117889400-117889422 CAGGTAGGGTGCTGGGAGACTGG + Intergenic
996486303 5:124039528-124039550 CATGTAAAGTGCCTAGTGTCTGG - Intergenic
999087246 5:148903825-148903847 CATGTAGTGTGGCTGGAATGTGG - Intergenic
999277170 5:150339049-150339071 CATCTAGGGTGACTGGGGTTGGG - Intronic
999414443 5:151382395-151382417 CAAGGAGCTTGCCTGGAGTCAGG - Intergenic
999715343 5:154355760-154355782 GATGGATGGTGCCTGGAGGCAGG - Intronic
1000766321 5:165295132-165295154 CATGACAGGTGCCTTGAGTCTGG - Intergenic
1001237138 5:170039619-170039641 AATGTAGGCTGCCTGAAATCAGG - Intronic
1001431282 5:171664697-171664719 CATATTAGGTGCCTGGAGCCTGG - Intergenic
1001757823 5:174184444-174184466 CATGCTGGGTGCCTAGACTCAGG - Intronic
1003384245 6:5652699-5652721 CTTGTGGGGTGCCTGGATTGAGG + Intronic
1004078136 6:12364113-12364135 CATGGAGGGTGCCTGGTGAAAGG + Intergenic
1005485627 6:26296452-26296474 CATGATGTGTGCCTGGTGTCTGG - Intergenic
1006143290 6:31943802-31943824 CATGCCAGGTGCCTGGAGTCTGG + Exonic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006700804 6:35971679-35971701 CATCTAGGAAGCATGGAGTCAGG + Intronic
1014678130 6:124393676-124393698 GGTATAGGGTGTCTGGAGTCAGG - Intronic
1014723874 6:124952452-124952474 TATGTTGGGGGCCTTGAGTCAGG - Intergenic
1019656609 7:2199420-2199442 CATGAAGGGCGCCTGCAGCCTGG + Intronic
1019762658 7:2825120-2825142 CCTGTTGGGTGCCTGGATTTAGG - Intronic
1021592197 7:22275335-22275357 CAGGAATGGTGCCAGGAGTCAGG - Intronic
1021972529 7:25980020-25980042 CATGGAGAGGGCCTGGAGGCAGG + Intergenic
1022253843 7:28635842-28635864 CAGGTAGGCTGCCAGGAGTTTGG - Intronic
1025139357 7:56449609-56449631 CATGTAGGGCACCTGGAATGTGG - Intergenic
1025854224 7:65264183-65264205 CATGTTGGGTGCAGGGAGTAGGG + Intergenic
1029258258 7:99284075-99284097 CCTGGAGGGTGCCAGGAGCCAGG + Intergenic
1030821154 7:114093444-114093466 CATGTAGGTTCCATGGAGCCAGG + Intronic
1032802329 7:135326982-135327004 CAGGTAGGGTCCCTGGAGCCAGG + Intergenic
1034612569 7:152385182-152385204 CCTGTAGAGTTCCTGTAGTCAGG - Intronic
1035264457 7:157683520-157683542 CCTGGAGAGTGACTGGAGTCAGG - Intronic
1035885123 8:3283305-3283327 CATGTAGGGAACCTGGAATCGGG + Intronic
1036273888 8:7333624-7333646 CAACTCGGGTGCCTGGAGGCAGG - Intergenic
1036347458 8:7976726-7976748 CAACTCGGGTGCCTGGAGGCAGG + Intergenic
1036842764 8:12137501-12137523 CAACTCGGGTGCCTGGAGGCAGG + Exonic
1038274710 8:26111244-26111266 CTTTGAGGGTGTCTGGAGTCTGG - Intergenic
1038566007 8:28620544-28620566 TATGTAATGTGCCTGGATTCCGG - Intronic
1039793623 8:40894477-40894499 CATGTAGGGTGAATGGAGGAAGG + Intronic
1043407591 8:79954092-79954114 CATGTAGTGTGCCTGGCTTCAGG - Intronic
1046611668 8:116432563-116432585 CATGTAGGCTCCTTGAAGTCTGG - Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1053167821 9:35856935-35856957 CATTTTGGGAGCCTGGAGACAGG - Intergenic
1057622273 9:96646720-96646742 GATGGAGGGTGCCTGGATCCCGG + Intronic
1057807897 9:98233673-98233695 CATGTAGGGTGCCTGGAGTCTGG - Intronic
1058919592 9:109600250-109600272 CAGGCAGGGGGCCTGGAGTAAGG + Intergenic
1060557673 9:124517469-124517491 CATGGAGGGTTGATGGAGTCAGG + Exonic
1062443235 9:136582862-136582884 CCCTTAAGGTGCCTGGAGTCAGG + Intergenic
1186517021 X:10173836-10173858 AATGTAGGGAGCCTGGGCTCAGG + Intronic
1188797606 X:34484550-34484572 CATCTAGCATGCCTGGAGCCTGG + Intergenic
1189232193 X:39461201-39461223 GATGTAGGGTACCTGGATTCTGG - Intergenic
1189716956 X:43877025-43877047 CATGTAGAGTGCTTGGAATGTGG - Intronic
1190111873 X:47595127-47595149 CATGTGGGGTTCCTGGAGGGTGG + Intronic
1190427656 X:50347735-50347757 CATGTAGAGGGCCAGGAGTAAGG - Exonic
1190832053 X:54067616-54067638 CATGAAGGGACCGTGGAGTCAGG + Intergenic
1197515539 X:127423125-127423147 CATGTAGGCTGCATGGGATCAGG - Intergenic
1199475981 X:148245722-148245744 CTTGTAGGGTTCCTGGAGTATGG + Intergenic
1200011953 X:153126361-153126383 CTCGCAGGGTGCCTGGAGTAGGG + Intergenic
1200027648 X:153273558-153273580 CTCGCAGGGTGCCTGGAGTAGGG - Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic