ID: 1057817319

View in Genome Browser
Species Human (GRCh38)
Location 9:98305116-98305138
Sequence AACACAGATCACCCTACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057817312_1057817319 22 Left 1057817312 9:98305071-98305093 CCACCTTCCTTTACTTTTGAGAC 0: 1
1: 0
2: 4
3: 93
4: 4046
Right 1057817319 9:98305116-98305138 AACACAGATCACCCTACTGCAGG No data
1057817311_1057817319 27 Left 1057817311 9:98305066-98305088 CCTGGCCACCTTCCTTTACTTTT 0: 1
1: 1
2: 9
3: 112
4: 1081
Right 1057817319 9:98305116-98305138 AACACAGATCACCCTACTGCAGG No data
1057817313_1057817319 19 Left 1057817313 9:98305074-98305096 CCTTCCTTTACTTTTGAGACTCA 0: 1
1: 0
2: 1
3: 29
4: 403
Right 1057817319 9:98305116-98305138 AACACAGATCACCCTACTGCAGG No data
1057817314_1057817319 15 Left 1057817314 9:98305078-98305100 CCTTTACTTTTGAGACTCACTTA 0: 1
1: 0
2: 0
3: 21
4: 170
Right 1057817319 9:98305116-98305138 AACACAGATCACCCTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057817319 Original CRISPR AACACAGATCACCCTACTGC AGG Intronic
No off target data available for this crispr