ID: 1057818701

View in Genome Browser
Species Human (GRCh38)
Location 9:98315048-98315070
Sequence TGGAATGTCAGCAGCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1177
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 1134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057818701 Original CRISPR TGGAATGTCAGCAGCACAGG GGG (reversed) Intronic
900388484 1:2421850-2421872 TGTAATCTCAGCTACACAGGAGG + Intergenic
900840417 1:5044908-5044930 TGGAATGTCATCAGTTAAGGTGG - Intergenic
900841582 1:5052762-5052784 TGGAATGTCATCAGTTAAGGTGG - Intergenic
900847929 1:5118552-5118574 TGGAATGTCATCAGTTAAGGCGG - Intergenic
901047820 1:6408933-6408955 TGGAATCCCAGCTGCACGGGAGG - Intergenic
901115676 1:6841915-6841937 TGGAATGACAGCATCTGAGGTGG - Intronic
901565844 1:10114312-10114334 ATGAATGTTAGCAGCAGAGGAGG + Intronic
902306012 1:15539904-15539926 TGTAATCTCAGCTGCTCAGGAGG + Intronic
903418641 1:23202216-23202238 TGTAATCTCAGCTACACAGGAGG - Intergenic
903482725 1:23665920-23665942 TGGAATCTCAACTGCTCAGGAGG + Intergenic
903797744 1:25942702-25942724 AGGAATGTCAGCAGCAACGCTGG + Intergenic
904223028 1:28988806-28988828 TGTAATGCCAGCTGCTCAGGAGG - Intronic
904948483 1:34216579-34216601 AGGAAGGTCAGCAGAAAAGGTGG + Intronic
904966776 1:34380286-34380308 TAGAATGTCAGCCTCACATGAGG + Intergenic
905332306 1:37213682-37213704 TGGAATGTCATCAGTTAAGGTGG + Intergenic
905947230 1:41913651-41913673 TGTAATGCCAGCTGCTCAGGAGG - Intronic
905992691 1:42353092-42353114 AGGAATGTCAGCAGCCCCTGGGG - Intergenic
907016233 1:51015971-51015993 TGGAATCTCAGCTACTCAGGAGG + Intergenic
907176710 1:52530744-52530766 TGTAATCTCAGCTGCATAGGAGG + Intronic
907520914 1:55022820-55022842 TGGAATGTCATCAGTTAAGGTGG - Intergenic
907521710 1:55027999-55028021 TGGAATGTCATCAGTTAAGGTGG - Intergenic
907717867 1:56944366-56944388 TGGAATTTCAGCAAGACAAGAGG - Intronic
908462078 1:64355634-64355656 TGGAATGTCATCAGTTAAGGTGG + Intergenic
908514065 1:64874513-64874535 TGGATTGTCAATTGCACAGGGGG + Intronic
908592417 1:65647900-65647922 TGGAATGTCATCAGTTAAGGCGG + Intergenic
908851971 1:68386116-68386138 TGGAATGTCATCAGTTAAGGCGG - Intergenic
908852851 1:68391675-68391697 TGGAATGTCATCAGTTAAGGCGG - Intergenic
909203930 1:72728412-72728434 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
909222306 1:72980762-72980784 TGGAATGTCATCAGTTAAGGTGG + Intergenic
909222993 1:72985356-72985378 TGGAATGTCATCAGTTAAGGTGG + Intergenic
909223210 1:72988115-72988137 TGGAATGTCATCAGTTAAGGTGG + Intergenic
909224028 1:72993468-72993490 TGGAATGTCATCAGTTAAGGTGG + Intergenic
909332581 1:74431742-74431764 TGCAGTGTCAGCAGCTCAGAAGG - Intronic
909677282 1:78252545-78252567 CGGAGTGTAAGCAGCACAGATGG - Intergenic
909791224 1:79680440-79680462 TGTAATCCCAGCTGCACAGGAGG + Intergenic
909792534 1:79696641-79696663 TGGAATGTCATCAGTTAAGGCGG + Intergenic
909909573 1:81245395-81245417 TGGAATGTCATCAGTTAAGGTGG - Intergenic
909910407 1:81250869-81250891 TGGAATGTCATCAGTTAAGGTGG - Intergenic
909977999 1:82067820-82067842 TGGAATGTCATCAGTTAAGGCGG + Intergenic
910686410 1:89921664-89921686 TGGAATCCCAGCTGCTCAGGAGG - Intronic
910998179 1:93131645-93131667 TGGAATGGCAGCTGAAGAGGGGG + Intronic
911158354 1:94657790-94657812 TGGAATGTCATCAGTTAAGGTGG + Intergenic
911190115 1:94940119-94940141 TGGATTTTCAACTGCACAGGGGG + Intergenic
911599768 1:99835378-99835400 TGTAATCCCAGCAACACAGGAGG + Intergenic
911746456 1:101446478-101446500 TGTAATGTCAGCTACTCAGGAGG - Intergenic
912365235 1:109127993-109128015 TGTAATCCCAGCTGCACAGGAGG - Intronic
912822099 1:112876032-112876054 TGGAATCTCAGCTACTCAGGAGG + Intergenic
912940097 1:114037187-114037209 TGGAATGTCATCAGTTAAGGTGG - Intergenic
914407803 1:147393430-147393452 TGTAATGCCAGCTGCTCAGGAGG + Intergenic
914925434 1:151882252-151882274 TGTAATGTCAGCGACTCAGGAGG + Intronic
915394102 1:155568974-155568996 TGGAATCTCAGCTACTCAGGAGG - Intergenic
915636368 1:157189806-157189828 AGGATTGTGAGCAGCAGAGGAGG + Intergenic
915797848 1:158755612-158755634 AGCAAGGTGAGCAGCACAGGTGG - Exonic
916411586 1:164551814-164551836 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
916522167 1:165573608-165573630 GAGAATGCCAGCAGCACAGAAGG + Intergenic
917288671 1:173448731-173448753 TGGAATGTCATCAGTTAAGGCGG + Intergenic
917973051 1:180220628-180220650 GGAGATGTCAGCTGCACAGGTGG - Intergenic
917979040 1:180258237-180258259 TGAAATGTCACCTGCTCAGGGGG - Intronic
918346633 1:183613322-183613344 TGGAATGTCATCAGTTAAGGCGG - Intergenic
918347563 1:183619054-183619076 TGGAATGTCATCAGTTAAGGCGG - Intergenic
918497986 1:185160578-185160600 TGTAATCTCAGCTGCTCAGGAGG + Intronic
918567218 1:185948595-185948617 TGGAATGTCATCAGTTAAGGTGG + Intronic
918568083 1:185954080-185954102 TGGAATGTCATCAGTTAAGGTGG + Intronic
918713958 1:187765825-187765847 TGGAATGTCATCAGTTAAGGTGG + Intergenic
919145549 1:193629946-193629968 TATAATATCAGCAGAACAGGAGG + Intergenic
919476006 1:198034725-198034747 TGGAATGTCATCAGTTGAGGCGG - Intergenic
920026909 1:203005745-203005767 TGGAATGTCATCAGTTAAGGCGG + Intergenic
920453837 1:206082394-206082416 TGTAATGTCAGCTACTCAGGAGG + Intronic
920629069 1:207634065-207634087 TGGAATGTCATCAGTAAAGGCGG + Intronic
920828996 1:209448917-209448939 TGGAATGTCATCAGTTAAGGTGG - Intergenic
920829765 1:209453664-209453686 TGGAATGTCATCAGTTAAGGTGG - Intergenic
921212146 1:212910120-212910142 TGGAATGTCATCAGTTAAGGTGG - Intergenic
921212779 1:212914312-212914334 TGGAATGTCATCAGTTAAGGTGG - Intergenic
921459347 1:215410429-215410451 TGGAATGTCATCAGTTAAGGTGG + Intergenic
921460145 1:215415549-215415571 TGGAATGTCATCAGTTAAGGTGG + Intergenic
921519789 1:216145713-216145735 TGGAATGTCATCAGTTAAGGTGG - Intronic
921520793 1:216152319-216152341 TGGAATGTCATCAGTTAAGGTGG - Intronic
921901652 1:220457461-220457483 TGTAATCCCAGCAGCTCAGGAGG + Intergenic
922048842 1:221971313-221971335 TGGAATGTCATCAGTTAAGGCGG - Intergenic
922049925 1:221978822-221978844 TGGAATGTCATCAGTTAAGGTGG + Intergenic
922153619 1:223024713-223024735 TGGAATGTCATCAGTTAAGGTGG + Intergenic
922154433 1:223030018-223030040 TGGAATGTCATCAGTTAAGGTGG + Intergenic
922219959 1:223550861-223550883 TGGGCTGGCAGCACCACAGGTGG - Intronic
922876938 1:228947536-228947558 TGGAATGTCATCAGTTAAGGAGG - Intergenic
922877519 1:228951609-228951631 TGGAATGTCATCAGTTAAGGTGG - Intergenic
922906028 1:229174373-229174395 TGGAATGTCATCAGTTAAGGTGG - Intergenic
922906846 1:229179839-229179861 TGGAATGTCATCAGTTAAGGCGG - Intergenic
922966745 1:229697057-229697079 TGGAATGTCATCAGTTAAGGCGG - Intergenic
923130280 1:231068953-231068975 TGGTAGGTCAGAAGCTCAGGAGG - Intergenic
923256887 1:232229926-232229948 TGGAATGTCATCAGTTAAGGCGG + Intergenic
923257634 1:232234865-232234887 TGGAATGTCATCAGTTAAGGTGG + Intergenic
923408184 1:233683746-233683768 TGGAATGTCATCAGTTAAGGCGG + Intergenic
923409009 1:233689070-233689092 TGGAATGTCATCAGTTAAGGCGG + Intergenic
923722135 1:236476068-236476090 TGTAATCTCAGCAACTCAGGAGG + Intronic
923829728 1:237541891-237541913 TGGAATGTCATCAGTTAAGGCGG + Intronic
923905542 1:238379754-238379776 TGGAATGTCATCAGTTAAGGTGG + Intergenic
923983172 1:239349753-239349775 TGTAATCCCAGCAGTACAGGAGG + Intergenic
924018083 1:239749544-239749566 TGTAATCACAGCTGCACAGGAGG + Intronic
924258946 1:242210430-242210452 TGGAATGTCATCAGTTAAGGCGG - Intronic
924608275 1:245553450-245553472 GGGACTGTCAGCGGCAGAGGAGG - Intronic
924666760 1:246081512-246081534 TGTAGTGTCAGCTGCTCAGGAGG - Intronic
1062968044 10:1625543-1625565 TGGAATCTAAGCTCCACAGGTGG + Intronic
1063159959 10:3412031-3412053 TGGAATGTCAGGAGGAGAGGAGG + Intergenic
1063364774 10:5483215-5483237 TGTAATCCCAGCTGCACAGGAGG + Intergenic
1063429096 10:5974119-5974141 TGTAATGTCAGCTACTCAGGAGG - Intronic
1063509149 10:6629895-6629917 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1063510008 10:6635409-6635431 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1063527242 10:6797399-6797421 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1063890109 10:10620274-10620296 TGGAATCCCAGCTACACAGGAGG + Intergenic
1064068539 10:12204869-12204891 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1064377050 10:14806275-14806297 TGTAATCTCAGCAACTCAGGAGG + Intergenic
1064908308 10:20371160-20371182 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1064968981 10:21044273-21044295 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1064974296 10:21097335-21097357 TGTAATCTCAGCAACTCAGGAGG + Intronic
1065261057 10:23923575-23923597 TGGAATGACAGAAGCAGAGATGG + Intronic
1065409812 10:25412337-25412359 TGGGCTGTCATCAGCACAGAAGG - Exonic
1065443550 10:25774783-25774805 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1065822621 10:29539988-29540010 TAGAATGATGGCAGCACAGGTGG - Intronic
1066498773 10:35970245-35970267 AGGAATGTGAGGAGCAGAGGAGG - Intergenic
1068057905 10:52034073-52034095 TGGAATGTCATCAGTTAAGGTGG + Intronic
1068058715 10:52039427-52039449 TGGAATGTCATCAGTTAAGGTGG + Intronic
1068160976 10:53263545-53263567 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1068178537 10:53493039-53493061 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1068179999 10:53504594-53504616 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1068230597 10:54166788-54166810 TGGAATGTCATCAGTTAAGGTGG - Intronic
1068231423 10:54172169-54172191 TGGAATGTCATCAGTTAAGGTGG - Intronic
1068303072 10:55170758-55170780 TGTAATCTCAGCTACACAGGAGG + Intronic
1068591890 10:58861311-58861333 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1068592777 10:58867197-58867219 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1068994127 10:63182981-63183003 TGTAATCTCAGCTGCTCAGGAGG - Intronic
1069465473 10:68634881-68634903 TGTAATCTCAGCTACACAGGAGG - Intronic
1069864191 10:71491289-71491311 TGGACTGACAGCAGCACTGGGGG - Intronic
1070000406 10:72372110-72372132 TGTAATCTCAGCAACTCAGGAGG + Intronic
1070060101 10:72973682-72973704 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1070081296 10:73190973-73190995 TGTAATCTCAGCAACTCAGGAGG - Intronic
1070713306 10:78699354-78699376 TCGAATGCCAGCTCCACAGGAGG - Intergenic
1071548244 10:86545117-86545139 TGTAATGCCAGCTGCTCAGGAGG - Intergenic
1071590167 10:86865162-86865184 TGGAATGTCATCAGTTAAGGTGG - Intronic
1071961577 10:90812922-90812944 TGGAATGTCATCAGTTAAGGCGG - Intronic
1072413932 10:95231305-95231327 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1072580053 10:96733117-96733139 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1073639935 10:105241451-105241473 TGGCATGTTAGCAGCTCAGTTGG + Intronic
1074629024 10:115229021-115229043 TGTAATCTCAGCACTACAGGAGG - Intronic
1074748990 10:116565580-116565602 TGTAATCTCAGCTACACAGGCGG - Intronic
1074824587 10:117205576-117205598 AGAAATCTCAGCAGGACAGGAGG - Intronic
1074833641 10:117268146-117268168 GGGAATTCCTGCAGCACAGGCGG - Intronic
1074940534 10:118232409-118232431 TGTAATCTCAGCAACTCAGGAGG - Intergenic
1076250356 10:128979794-128979816 TGGGGTGTCAGCTGCGCAGGGGG + Intergenic
1076729958 10:132433425-132433447 TGTAATCTCAGCAACTCAGGAGG - Intergenic
1076993209 11:286171-286193 TGGAGTCTCAGCAGCCCAGCAGG - Intergenic
1077046267 11:547108-547130 TGTAATGCCAGCTGCACAGGAGG + Intronic
1077245004 11:1532501-1532523 TGCAATCTCAGGAGCCCAGGTGG - Intergenic
1077315824 11:1918994-1919016 TGCAATGGCAGCAGCCCCGGGGG + Intergenic
1077398475 11:2339433-2339455 TGGAATGTCATCAGGTAAGGTGG - Intergenic
1077468386 11:2744875-2744897 TGGAATGGCTGCAGGGCAGGTGG - Intronic
1077850360 11:6070139-6070161 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1077851210 11:6075750-6075772 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1078000499 11:7490861-7490883 TGGAAGGTCTGCATGACAGGAGG - Intronic
1078046492 11:7917773-7917795 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1079672125 11:23184249-23184271 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1079672944 11:23189608-23189630 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1079725873 11:23880016-23880038 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1080027462 11:27629385-27629407 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1080028301 11:27634792-27634814 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1081168440 11:39835871-39835893 TGGAATCCCAGCACCTCAGGAGG + Intergenic
1081329340 11:41785097-41785119 TGGTTTGTCAGAAGCACAGGTGG + Intergenic
1081864989 11:46354450-46354472 TGTAATCTCAGCAACTCAGGAGG - Intronic
1081876447 11:46411588-46411610 TGCAATCTCAGCTGCTCAGGAGG - Intronic
1082028939 11:47591198-47591220 TGTAATGTCAGCTACTCAGGAGG - Intronic
1082105560 11:48217516-48217538 TGTGATGTGAGAAGCACAGGTGG - Exonic
1083543253 11:63529634-63529656 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1084046816 11:66573709-66573731 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1084203708 11:67578603-67578625 TGATATCTCGGCAGCACAGGAGG - Intergenic
1084355002 11:68632462-68632484 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1084355996 11:68639107-68639129 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1084528586 11:69713068-69713090 TGTAATGCCAGCTGCTCAGGAGG + Intergenic
1084894577 11:72256492-72256514 GGGAATGTCAGCAAGACAGAAGG + Intergenic
1085307418 11:75495848-75495870 TGTGAAGTCACCAGCACAGGGGG - Intronic
1085638308 11:78174841-78174863 TAGAATGTCGGCAGCAGAGGGGG - Intronic
1085686494 11:78627357-78627379 TGTAATCTCAGCAACTCAGGAGG - Intergenic
1086614951 11:88805311-88805333 TGTAATCTCAGCTACACAGGAGG - Intronic
1087315123 11:96593336-96593358 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1088031859 11:105261197-105261219 TGGTATGTGAGAAACACAGGGGG - Intergenic
1088574592 11:111257994-111258016 TGTAATGTCAGCTACTCAGGAGG + Intronic
1088841328 11:113629928-113629950 TGGAGAGTCCGCAGCGCAGGAGG + Intergenic
1089349437 11:117814009-117814031 TGGAATGTCATCAGTTAAGGCGG - Intronic
1089353655 11:117836008-117836030 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1089424638 11:118362242-118362264 TGGAATCTCAGCTACTCAGGAGG - Intronic
1089866526 11:121637667-121637689 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1089867395 11:121643426-121643448 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1089954154 11:122555266-122555288 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1090871516 11:130753814-130753836 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1090872305 11:130759004-130759026 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1091747194 12:2999913-2999935 AGGAAGGTGAGAAGCACAGGAGG - Intronic
1091886158 12:4018653-4018675 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1091886881 12:4023355-4023377 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1092150832 12:6247280-6247302 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1092495403 12:8988700-8988722 TGTAATCTCAGCTGCTCAGGAGG - Intronic
1092498638 12:9023810-9023832 TGTAATCCCAGCAGCCCAGGAGG - Intergenic
1092626236 12:10332695-10332717 TGGATTGTCAACTGCAGAGGAGG - Intergenic
1092626314 12:10333294-10333316 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1092627104 12:10338509-10338531 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1092723293 12:11462485-11462507 TGGAATGTCATCAGTTAAGGTGG + Intronic
1092724091 12:11467886-11467908 TGGAATGTCATCAGTTAAGGTGG + Intronic
1093070803 12:14705768-14705790 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1093071525 12:14710506-14710528 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1093578370 12:20763021-20763043 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1093579245 12:20768721-20768743 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1093584859 12:20822484-20822506 TGGAATGTCATCAGTTAAGGCGG + Intronic
1094006425 12:25757149-25757171 GGGGATGTCAGCTGCACAGAGGG + Intergenic
1094573042 12:31658891-31658913 TTGAATGTAGGCAGCACAGAGGG + Intronic
1094825392 12:34265654-34265676 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1095473586 12:42563059-42563081 TGTAATCTCAGCTACACAGGAGG + Intronic
1096606344 12:52769080-52769102 AGCAATGTCACCAGCACAAGTGG - Exonic
1096754107 12:53784467-53784489 TGTAATCTCAGCAACTCAGGAGG - Intergenic
1097198725 12:57260140-57260162 TGTAGTCTCAGCAGCTCAGGAGG + Intronic
1097398178 12:59101756-59101778 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1097404497 12:59174228-59174250 TGTAATGCCAGCTGCTCAGGAGG - Intergenic
1097416609 12:59323535-59323557 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1097669305 12:62516956-62516978 TGGAAAGTCAACAGGATAGGAGG + Intronic
1097757280 12:63420491-63420513 GGCAATGTCAGCAGCACAACAGG + Intergenic
1098041501 12:66358013-66358035 TGTAATCTCAGCAACTCAGGAGG - Intronic
1098173221 12:67767122-67767144 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1098173983 12:67772212-67772234 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1098591201 12:72215321-72215343 TGGAATGTCATCAGTTAAGGTGG + Intronic
1098628692 12:72703334-72703356 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1098629491 12:72708634-72708656 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1098638876 12:72816456-72816478 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1098653205 12:73000988-73001010 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1099131674 12:78840914-78840936 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1099188351 12:79539960-79539982 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1099189166 12:79545287-79545309 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1099676317 12:85765079-85765101 TGTAATCTCAGCAGCTCAGACGG + Intergenic
1099762216 12:86938794-86938816 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1099763078 12:86944417-86944439 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1100256135 12:92885183-92885205 ATGAATTTCAGCTGCACAGGAGG + Intronic
1100561800 12:95754570-95754592 TGGAATGTCATCAGTTAAGGCGG - Intronic
1101277908 12:103222433-103222455 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1101278786 12:103228421-103228443 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1101341222 12:103842731-103842753 TGTAATGTCAGCTACTCAGGAGG - Intronic
1101350583 12:103926938-103926960 TGTAATTCCAGCTGCACAGGAGG - Intergenic
1101395286 12:104341828-104341850 TGGTAGGTCAGAAGTACAGGAGG - Intronic
1101609693 12:106279293-106279315 TGGCATGTTAGCAGCTCAGTCGG + Intronic
1102242787 12:111335587-111335609 TGGAATCCCAGCAACTCAGGAGG + Intronic
1102404988 12:112665310-112665332 GGGAATGTCAGCAACAAAAGGGG + Intronic
1102443233 12:112979380-112979402 AGGGACGTCAGCAGCTCAGGAGG - Intronic
1102476316 12:113191210-113191232 TGGGATGGCAGCAGCAGAGGAGG - Intronic
1102699362 12:114825700-114825722 TGTAATCTCAGCTACACAGGAGG + Intergenic
1103496686 12:121368205-121368227 TGTAATCTCAGCTGCTCAGGAGG - Intronic
1103743067 12:123104412-123104434 TGGAATGTCATCAGTTAAGGCGG - Intronic
1103932130 12:124456437-124456459 TGCCATGTCAGCAGCAGAGCTGG - Intronic
1104758902 12:131285536-131285558 TGAGATGGAAGCAGCACAGGAGG - Intergenic
1104821708 12:131680960-131680982 TGAGATGGAAGCAGCACAGGAGG + Intergenic
1105948750 13:25211454-25211476 TCACATGTCAGCAGCATAGGTGG - Intergenic
1106432565 13:29694899-29694921 TGGGATCTCAGCAGGAGAGGTGG - Intergenic
1106482080 13:30144177-30144199 TGGAATGTAAGCAGAAGTGGTGG - Intergenic
1106984843 13:35334389-35334411 TGTAATGTCAGCTACTCAGGAGG - Intronic
1107076022 13:36321853-36321875 TGGAATGTCATCAGTTAAGGTGG - Intronic
1107518912 13:41160056-41160078 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1108512628 13:51169978-51170000 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1108513352 13:51174668-51174690 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1108582284 13:51837786-51837808 TGGAGGGTCAGCAGAACAAGGGG - Intergenic
1108813994 13:54268254-54268276 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1108912975 13:55578542-55578564 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1108913799 13:55583953-55583975 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1108919104 13:55655248-55655270 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1108919914 13:55660668-55660690 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1108947076 13:56040363-56040385 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1108947909 13:56045937-56045959 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1108952264 13:56110094-56110116 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1108952502 13:56112726-56112748 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1108953311 13:56118125-56118147 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1109709221 13:66141629-66141651 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1109710017 13:66146902-66146924 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1109716290 13:66226685-66226707 TGGAATGTCATCAGTCAAGGTGG + Intergenic
1109717164 13:66232206-66232228 TGGAATGTCATCAGTCAAGGTGG + Intergenic
1109929574 13:69197383-69197405 TGGAATGTCATCAGTCAAGGTGG + Intergenic
1110543851 13:76735091-76735113 TGGAATATGAGCAGGACAGGAGG - Intergenic
1110765923 13:79279487-79279509 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1110845857 13:80189644-80189666 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1111119904 13:83833494-83833516 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1111301641 13:86358280-86358302 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1111302485 13:86363798-86363820 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1111458400 13:88513135-88513157 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1111459251 13:88518609-88518631 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1111630115 13:90839676-90839698 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1111630876 13:90844823-90844845 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1111631261 13:90848889-90848911 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1111632046 13:90854144-90854166 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1112016784 13:95337868-95337890 TGGAATGTCATAAGAATAGGAGG + Intergenic
1112083341 13:96001212-96001234 TGGAATGTCATCAGTTAAGGTGG - Intronic
1112222943 13:97509575-97509597 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1112894004 13:104274971-104274993 TGTAATCTCAGCAACTCAGGAGG - Intergenic
1113323896 13:109265202-109265224 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1113324785 13:109270796-109270818 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1113462060 13:110489112-110489134 TGTAATCCCAGCTGCACAGGAGG + Intronic
1113544714 13:111139448-111139470 TGAACTGTCAGAATCACAGGAGG + Intronic
1114082815 14:19216289-19216311 TGTAATGTCAGCTACACTGGAGG + Intergenic
1115209060 14:30946420-30946442 TGGAATCTGAGCAACTCAGGAGG + Intronic
1115904414 14:38190750-38190772 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1115905264 14:38196191-38196213 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1115925714 14:38431144-38431166 TGTAATGTCAGCTACTCAGGAGG + Intergenic
1116179302 14:41515982-41516004 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1116185853 14:41600036-41600058 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1116613160 14:47104307-47104329 TGGAATGTCATCAGTTAAGGTGG - Intronic
1116613810 14:47108427-47108449 TGGAATGTCATCAGTTAAGGTGG - Intronic
1116952539 14:50893274-50893296 TGGAATGTCATCAGTTAAGGTGG - Intronic
1117064181 14:51992906-51992928 TGTAATCTCAGCTGCCCAGGGGG + Intronic
1117089196 14:52233156-52233178 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1117868767 14:60175999-60176021 TGGGATGTCCGCTGCACAGAAGG + Intergenic
1118198338 14:63648897-63648919 TGTAATGCCAGCTGCTCAGGAGG - Intergenic
1118682137 14:68252959-68252981 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1118683195 14:68264539-68264561 TGGAATGCCAGAAGTACAGGAGG + Intronic
1119240512 14:73055823-73055845 TGTAATCCCAGCAGCTCAGGAGG - Intergenic
1120167061 14:81212036-81212058 TAGAATGTTAGCAGCACAACTGG - Intronic
1120230661 14:81837239-81837261 TGAAATGTGAGAAGCACATGAGG + Intergenic
1120305160 14:82760466-82760488 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1120884363 14:89440475-89440497 TGGAATGTCATCAGTTAAGGTGG - Intronic
1121067592 14:90983153-90983175 TGGAATCCCAGCTACACAGGAGG + Intronic
1122040633 14:98985317-98985339 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1122041728 14:98992572-98992594 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1122204561 14:100142119-100142141 TGGAATGACAGCAGCTCAGGTGG - Intronic
1122477234 14:102018828-102018850 TGTAATGTCAGCTTCCCAGGAGG + Intronic
1122528972 14:102411405-102411427 TGGAATGTCATCAGTTAAGGCGG - Intronic
1122570484 14:102695665-102695687 TGTAATCTCAGCTGCTCAGGAGG - Intronic
1125039557 15:35168725-35168747 TGGAATGTCAGCAGCTAAGTAGG + Intergenic
1125045369 15:35238741-35238763 TGGAATGTCATCAGTTAAGGCGG - Intronic
1125046128 15:35243516-35243538 TGGAATGTCATCAGTTAAGGCGG - Intronic
1125131075 15:36285936-36285958 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1125182647 15:36895164-36895186 TGGATGGTCAGCAACACATGGGG - Exonic
1125668285 15:41450072-41450094 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1125958290 15:43806748-43806770 TGTAATCTCAGCTACACAGGAGG + Intronic
1125962338 15:43841987-43842009 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1126088315 15:45029581-45029603 TGGCATGTTAGCAGCTCAGTTGG + Intronic
1126186841 15:45839163-45839185 TGTAATCTCAGCACCCCAGGAGG - Intergenic
1126321436 15:47428650-47428672 TGGAATCTCAGCTACTCAGGTGG + Intronic
1126938719 15:53741514-53741536 TGAAATGTAGGCAGCTCAGGTGG - Intronic
1127307142 15:57718471-57718493 TGTAATGTCAGCTACTCAGGAGG - Intronic
1127938644 15:63670221-63670243 TGATATGTCAGCGGCACAGTCGG + Intronic
1128018761 15:64371716-64371738 TGTAATGCCAGCTGCTCAGGAGG - Intronic
1128282039 15:66403847-66403869 TGGTATGAAAGCAGCAAAGGGGG - Intronic
1128832357 15:70781145-70781167 TGTAATGTCAGCTACTCAGGGGG - Intergenic
1129353688 15:74973167-74973189 TAGAATGTCAGCTGTCCAGGAGG + Intronic
1129477919 15:75798964-75798986 TGTAATGCCAGCTACACAGGAGG + Intergenic
1130945470 15:88547584-88547606 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1130947837 15:88562129-88562151 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1131376923 15:91932562-91932584 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1131516089 15:93077827-93077849 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1131541453 15:93278687-93278709 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1131882072 15:96872182-96872204 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1131882892 15:96877533-96877555 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1132209182 15:100007819-100007841 TGGAAAGTCATGAGCAAAGGAGG + Intronic
1132340035 15:101072598-101072620 TGGAATGTCATCAGTTAAGGCGG - Intronic
1132340876 15:101077955-101077977 TGGAATGTCATCAGTTAAGGTGG - Intronic
1132487579 16:203027-203049 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1132646231 16:1000539-1000561 TGGAATGCCAGCAGGAAAGTCGG + Intergenic
1132688289 16:1171310-1171332 GGGGCTGTCAGCAGCCCAGGGGG + Intronic
1133281581 16:4669310-4669332 TGTAATCTCAGCAACTCAGGAGG + Intronic
1133440080 16:5814168-5814190 AGGGATGTGGGCAGCACAGGCGG - Intergenic
1133815547 16:9194850-9194872 TAGAATGTGAGCTCCACAGGGGG - Intergenic
1133869037 16:9670844-9670866 TGGAATGTCATCAGTTAAGGCGG + Intronic
1133869987 16:9677167-9677189 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1134211102 16:12277694-12277716 TGTAGTGTCAGCTGCTCAGGAGG - Intronic
1134289876 16:12895825-12895847 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1134341743 16:13352908-13352930 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1134342487 16:13357922-13357944 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1134684513 16:16149228-16149250 TGTAATCTCAGCTGCACGGGAGG + Exonic
1135267051 16:21036202-21036224 TGTAATGTCAGCTACCCAGGAGG + Intronic
1135968233 16:27052989-27053011 TGGACTGTAAGCAGCAGAGTTGG - Intergenic
1136356290 16:29746428-29746450 TGTAATCTCAGCTGCTCAGGCGG + Intergenic
1136586344 16:31188028-31188050 GGAAATGTCCTCAGCACAGGTGG - Intronic
1137659731 16:50194335-50194357 TGTAATCTCAGCAACTCAGGAGG - Intronic
1137998034 16:53241427-53241449 AGGAATTTCAGCAGTACAGATGG - Intronic
1138018232 16:53451382-53451404 TGTAATTTCAGCTGCCCAGGAGG + Intronic
1138758278 16:59515277-59515299 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1138795944 16:59969058-59969080 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1138804522 16:60078647-60078669 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1138805394 16:60084240-60084262 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1139225470 16:65230122-65230144 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1139226226 16:65235216-65235238 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1139230137 16:65275555-65275577 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1139567858 16:67790819-67790841 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1139687761 16:68617561-68617583 TGGAATGTCAGACGCAAAGACGG - Intergenic
1139943373 16:70621926-70621948 TGGAATGTCATCAGTTAAGGGGG + Intronic
1140498934 16:75415972-75415994 TGTAATGTCAGCTACTCAGGAGG - Intronic
1140632403 16:76869958-76869980 TGGAATGTGAGGAGGACATGAGG - Intergenic
1140705579 16:77625690-77625712 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1140709052 16:77659363-77659385 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1141120414 16:81350635-81350657 TGCAATCCCAGCAGCTCAGGAGG - Intronic
1141221262 16:82071106-82071128 GTGAATGTCAGCAGCATGGGAGG + Exonic
1141666518 16:85468436-85468458 TGTAATGTCAGCTACTCAGGAGG - Intergenic
1141738633 16:85873684-85873706 TGTAATCCCAGCAGCTCAGGAGG - Intergenic
1141864750 16:86742328-86742350 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1141865552 16:86747521-86747543 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1142020936 16:87781968-87781990 TGTAATGCCAGCAACTCAGGAGG + Intergenic
1142241923 16:88951282-88951304 TGGACTGGCACCAGCACAGAGGG + Exonic
1142564754 17:832766-832788 TTGCATCTCAGGAGCACAGGAGG + Intronic
1142740512 17:1929262-1929284 TGGTATGTCAGCTGCACATGGGG + Intergenic
1142796751 17:2313612-2313634 TGTAATGCCAGCAACTCAGGAGG + Intronic
1143125805 17:4640317-4640339 TGGAAGGTCTGCAGCAGAGGTGG + Intronic
1143402671 17:6656505-6656527 TGGAAGGTCTGCAGCAGAGGTGG - Intergenic
1143787627 17:9267867-9267889 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1144104258 17:11971868-11971890 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1144596343 17:16573196-16573218 TGTAATCTCAGCAACTCAGGAGG + Intergenic
1144712423 17:17410666-17410688 TGGCATGTCAGAAATACAGGAGG + Intergenic
1144932848 17:18874159-18874181 TGGAATCTCAGCAATATAGGAGG - Intronic
1144996013 17:19269285-19269307 GGGAATGTCTCCAGCAGAGGAGG + Intronic
1145757900 17:27406188-27406210 TGTAATCCCAGCAGCTCAGGAGG - Intergenic
1146196267 17:30815663-30815685 TGTAATGCCAGCTGCTCAGGAGG - Intronic
1146341521 17:32023241-32023263 TGTAATCTCAGCAACTCAGGAGG - Intronic
1146351280 17:32096382-32096404 TGTAATCTCAGCAACTCAGGAGG + Intergenic
1146532199 17:33617762-33617784 TGGATTTTCAGCAGCAAAGGTGG - Intronic
1146597505 17:34183303-34183325 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1146598347 17:34188686-34188708 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1146726710 17:35162204-35162226 TGGCCAGTCAGAAGCACAGGTGG + Intronic
1146808593 17:35885279-35885301 TGGATTGTGAGGAGCACAGGAGG + Intergenic
1147047329 17:37763032-37763054 TGGAATATGTGCAGCACATGGGG + Intergenic
1147173928 17:38639819-38639841 TGTAATCTCAGCTACACAGGAGG + Intergenic
1147197266 17:38775501-38775523 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1147553579 17:41462339-41462361 TGGCATGTCAGCAGGACAATAGG - Intronic
1147751106 17:42734167-42734189 TGTAATGTCAGCAACTCAGGAGG - Intronic
1148057119 17:44806149-44806171 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1148392162 17:47280476-47280498 TGGAATCTCAGCTACTCAGGAGG - Intronic
1148439595 17:47704862-47704884 TGGAATATTTGCAGCCCAGGGGG + Intronic
1148484018 17:47978948-47978970 AGGCATGGCACCAGCACAGGTGG + Intronic
1148512596 17:48185239-48185261 GGGAGGGACAGCAGCACAGGGGG + Intronic
1148555667 17:48577388-48577410 TGGAATCTGAGCAGCAAGGGTGG - Intronic
1149142916 17:53455989-53456011 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1149581027 17:57750479-57750501 TGGAATACCAGCTGCAGAGGTGG - Intergenic
1150308286 17:64105363-64105385 TGTAATCTCAGCAACTCAGGAGG - Intronic
1150560576 17:66290816-66290838 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1150560787 17:66292922-66292944 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1150737079 17:67750086-67750108 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1151630960 17:75310569-75310591 TGTAATTCCAGCTGCACAGGAGG - Intergenic
1152329819 17:79666095-79666117 TGGAGGGTCAGCAGTGCAGGGGG + Intergenic
1153837382 18:8976212-8976234 TGTAGTCTCAGCAGCCCAGGAGG + Intergenic
1154301013 18:13192585-13192607 TGTAATCTCAGCAACTCAGGAGG - Intergenic
1155697394 18:28698747-28698769 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1155791090 18:29971663-29971685 TGTAATGTCAGCAACTCGGGAGG - Intergenic
1155991277 18:32281888-32281910 TGGAATGTCATCAGTTAAGGTGG - Intronic
1156923588 18:42552755-42552777 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1156924387 18:42558008-42558030 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1157101937 18:44738650-44738672 TGGAATGCCAGCTCCTCAGGAGG + Intronic
1157448511 18:47767136-47767158 TGTAATATCAGCTGCTCAGGAGG + Intergenic
1157896187 18:51470500-51470522 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1158275736 18:55765165-55765187 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1158335980 18:56415548-56415570 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1158336809 18:56421006-56421028 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1158393925 18:57064965-57064987 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1158395027 18:57072368-57072390 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1158410884 18:57204942-57204964 TGTAATCTCAGCAACTCAGGAGG + Intergenic
1158709441 18:59824352-59824374 GGCAATGGCACCAGCACAGGTGG - Intergenic
1158954988 18:62529036-62529058 TGTAGTGCCAGCTGCACAGGAGG + Intronic
1159244728 18:65790745-65790767 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1159290032 18:66405370-66405392 TGTAATGTCAGCTACTCAGGAGG - Intergenic
1159414583 18:68127315-68127337 TGTAATGTCAGCTACTCAGGAGG + Intergenic
1159834668 18:73324727-73324749 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1159835492 18:73330043-73330065 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1160130562 18:76221657-76221679 TGGAACCTCAGCCGGACAGGAGG - Intergenic
1160157337 18:76443632-76443654 TGGAAGGTGAGCTGCACAGGTGG + Intronic
1160614788 18:80116899-80116921 TGTAATTCCAGCAGCTCAGGAGG - Intronic
1160702657 19:515614-515636 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1161831551 19:6608805-6608827 TGTAATGTCAGCTACTCAGGAGG - Intergenic
1162318838 19:9958913-9958935 TGTAATCTCAGCAGCTCAGGAGG + Intergenic
1162751363 19:12831582-12831604 TGTAATCTCAGCAGTTCAGGAGG + Intronic
1162787019 19:13041670-13041692 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1163344014 19:16728404-16728426 TGTAATCTCAGCTGCTCAGGAGG - Intronic
1163499960 19:17670360-17670382 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1163646896 19:18494739-18494761 GGGTCTGTCATCAGCACAGGTGG - Intronic
1163663492 19:18592272-18592294 AGGAAGGTCAGCAGCGCAGTGGG - Exonic
1163895985 19:20059720-20059742 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1163899336 19:20088001-20088023 TGGAATGTCATCAGTTAAGGTGG + Intronic
1163900655 19:20096647-20096669 TGGAATGTCATCAGTTAAGGTGG + Intronic
1163907623 19:20160946-20160968 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1163910487 19:20186902-20186924 TGTAATCTCAGCTACACAGGAGG - Intronic
1164152617 19:22568382-22568404 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1164153574 19:22574650-22574672 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1164206336 19:23061963-23061985 TGGAATCACAGCCTCACAGGTGG + Intergenic
1164549831 19:29200493-29200515 TGTAATCTCAGCTACACAGGAGG - Intergenic
1165544425 19:36522332-36522354 TGTAATGCCAGCTACACAGGAGG + Intronic
1165549131 19:36568591-36568613 TGTAATCCCAGCTGCACAGGAGG - Intronic
1165823356 19:38691491-38691513 TCAAATGTCAGCAACCCAGGAGG - Intronic
1165954471 19:39493516-39493538 TGGAATGTCATCAGTTAAGGCGG - Intronic
1166025855 19:40084019-40084041 TGTAATCCCAGCTGCACAGGAGG - Intronic
1166056875 19:40295555-40295577 TGTAATGTCAGCTACTCAGGAGG - Intergenic
1166062017 19:40331914-40331936 TGTAATGCCAGCAACTCAGGAGG + Intronic
1166498490 19:43323810-43323832 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1166499344 19:43329250-43329272 TGGAATGTCATCAGATAAGGCGG + Intergenic
1166759007 19:45213017-45213039 TGGCTTGTCAGCAGCATAGATGG + Exonic
1166850297 19:45756860-45756882 TGGAATGTGAGAAGCTCAGAGGG - Intronic
1167012445 19:46817593-46817615 TGTAATCTCAGCAACTCAGGAGG + Intergenic
1167099074 19:47392941-47392963 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1167447253 19:49544864-49544886 TGGAGTGTCATGAGCAGAGGAGG + Intronic
1167684512 19:50948241-50948263 TGTAATCTCAGCTGCTCAGGAGG - Intronic
1167785735 19:51634765-51634787 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1167922067 19:52790088-52790110 TGGAATGTCATCAGTTAAGGTGG + Intronic
1168051258 19:53831516-53831538 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1168052088 19:53837010-53837032 TGGAATGTCATCAGTTAAGGTGG - Intergenic
925330508 2:3054844-3054866 AAGAATGGCAGCAACACAGGTGG + Intergenic
925544144 2:5000881-5000903 TGGAATGTCATCAGTTAAGGTGG - Intergenic
925544998 2:5006393-5006415 TGGAATGTCATCAGTTAAGGTGG - Intergenic
925828383 2:7873022-7873044 TGGAATGTCATCAGTTAAGGTGG + Intergenic
925829314 2:7878755-7878777 TGGAATGTCATCAGTTAAGGTGG + Intergenic
926413204 2:12626447-12626469 TGGAATGTCATCAGTTAAGGTGG - Intergenic
926414035 2:12631912-12631934 TGGAATGTCATCAGTTAAGGTGG - Intergenic
926815101 2:16792241-16792263 TGGAATGTCATCAGTTAAGGCGG + Intergenic
926815924 2:16797569-16797591 TGGAATGTCATCAGTTAAGGCGG + Intergenic
927560793 2:24071481-24071503 TGTAATCTCAGCAACTCAGGAGG + Intronic
927780024 2:25931757-25931779 TGTAATCTCAGCTGCTCAGGAGG - Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928804209 2:35131458-35131480 TGGAGTGTCAGTTGCTCAGGAGG + Intergenic
928970544 2:37023645-37023667 TGTAATGTCAGCAGCTCAGGAGG + Intronic
929097027 2:38272797-38272819 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
929717816 2:44331334-44331356 TGTAATGTCAGCTACTCAGGAGG - Intronic
929758526 2:44787600-44787622 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
930028074 2:47041629-47041651 TGTAATCTCAGCTGCTCAGGAGG + Intronic
931025946 2:58113730-58113752 TGGAATGTCATCAGTTAAGGCGG + Intronic
931026760 2:58118996-58119018 TGGAATGTCATCAGTTAAGGCGG + Intronic
931398312 2:61907810-61907832 TGTAATCTCAGCTACACAGGAGG - Intronic
931587874 2:63847778-63847800 TGGAATGTCATCAGTTAAGGTGG + Intronic
931625391 2:64252528-64252550 TGGAATGTCATCAGTCAAGGTGG - Intergenic
931626133 2:64257309-64257331 TGGAATGTCATCAGTCAAGGTGG - Intergenic
931850050 2:66243999-66244021 TGGAATGTCATCAGTTAAGGTGG - Intergenic
931850843 2:66249209-66249231 TGGAATGTCATCAGTCAAGGTGG - Intergenic
932163680 2:69486216-69486238 TGTAATGTCAGCAACTCAGGAGG - Intronic
932307586 2:70714988-70715010 GGGAATTTCAGCAGCAATGGGGG - Intronic
932358538 2:71086674-71086696 TGGAATGTCATCAGTTAAGGTGG + Intergenic
932391837 2:71398394-71398416 TGTCATGTCAGCAGCACTCGGGG + Intronic
932973472 2:76573941-76573963 TGGAATGTCATCAGTTAAGGTGG + Intergenic
932974331 2:76579570-76579592 TGGAATGTCATCAGTTAAGGTGG + Intergenic
933012700 2:77088336-77088358 TGGAATGTCATCAGTTAAGGTGG - Intronic
933013535 2:77093779-77093801 TGGAATGTCATCAGTTAAGGCGG - Intronic
933329238 2:80876096-80876118 TGGAATGTCATCAGTTAAGGCGG + Intergenic
933329882 2:80880027-80880049 TGGAATGTCATCAGTTAAGGCGG + Intergenic
934680938 2:96283543-96283565 TTGGATGTCTGCTGCACAGGTGG + Exonic
936085705 2:109467486-109467508 TGGAAGGACAGCAGGACTGGGGG + Intronic
936682549 2:114790789-114790811 TGGAATGTCATCAGTTAAGGTGG + Intronic
936882985 2:117278865-117278887 TGGAATGTCATCAGTTAAGGTGG - Intergenic
936883766 2:117284141-117284163 TGGAATGTCATCAGTTAAGGTGG - Intergenic
936991329 2:118369678-118369700 TGGAATGTCATCAGTTAAGGCGG + Intergenic
937052864 2:118906533-118906555 TGGAATGTCATCAGCTGAGGAGG - Intergenic
937326744 2:120993974-120993996 AGCAATGACAGAAGCACAGGAGG + Intergenic
938318889 2:130348940-130348962 TGTAATCCCAGCAGCTCAGGAGG + Intergenic
938493762 2:131780330-131780352 TGTAATGTCAGCTACACTGGAGG - Intergenic
938857015 2:135323887-135323909 TGTAATCTCAGCTGCTCAGGAGG - Intronic
939307921 2:140432066-140432088 TGGAATGTCATCAGTTAAGGCGG - Intronic
939631927 2:144536093-144536115 TGTAATGTCAGCTACTCAGGAGG - Intergenic
939643372 2:144667575-144667597 TGTAATGCCAGCTGCTCAGGAGG - Intergenic
940426248 2:153534815-153534837 TGGAATGTCATCAGTTAAGGTGG + Intergenic
940529819 2:154867387-154867409 TGGAATGTCATCAGTTAAGGCGG - Intergenic
940530852 2:154874224-154874246 TGGAATGTCATCAGTTAAGGTGG - Intergenic
941353041 2:164459272-164459294 TGGAATGTCATCAGTTAAGGTGG - Intergenic
941455328 2:165707898-165707920 TGGAATGTCATCAGTTAAGGTGG + Intergenic
941456541 2:165716064-165716086 TGGAATGTCATCAGTTAAGGTGG + Intergenic
942035601 2:172007809-172007831 TGTAATCTCAGCTACACAGGAGG - Intronic
942731052 2:179061029-179061051 TGGAATGTCATCAGTTAAGGTGG + Intergenic
943104717 2:183530018-183530040 TGGAATGTCATCAGTTAAGGTGG - Intergenic
943413293 2:187566014-187566036 TGGAATGTCATCAGTTAAGGTGG + Intergenic
943421140 2:187670797-187670819 TGGAATGTCATCAGTTAAGGTGG + Intergenic
943421948 2:187676135-187676157 TGGAATGTCATCAGTCAAGGTGG + Intergenic
944259320 2:197658639-197658661 TAGAATTTGAACAGCACAGGTGG + Intronic
944387086 2:199179477-199179499 TGGAATGTCATCAGTTAAGGCGG - Intergenic
944394587 2:199252346-199252368 TGGAATGTCATCAGTTAAGGTGG - Intergenic
944576449 2:201095569-201095591 TGTAATCTCAGCAACTCAGGAGG - Intergenic
944791107 2:203128206-203128228 TGTAATGTCAGCTACTCAGGGGG - Intronic
944848507 2:203692736-203692758 TGGAATGTCAGCAACAAGGCAGG + Intergenic
945152655 2:206807155-206807177 TGGAATGTCATCAGTTAAGGCGG + Intergenic
945153477 2:206812493-206812515 TGGAATGTCATCAGTTAAGGCGG + Intergenic
945375735 2:209078132-209078154 TGGAATGTCATCAGTTAAGGCGG - Intergenic
945376615 2:209084041-209084063 TGGAATGTCATCAGTTAAGGCGG - Intergenic
945393969 2:209299425-209299447 TGGAATGTCATCAGTTAAGGTGG - Intergenic
945394740 2:209304599-209304621 TGGAATGTCATCAGTTAAGGTGG - Intergenic
945403823 2:209422323-209422345 TGTAATCCCAGCAGCTCAGGAGG - Intergenic
946351040 2:219152922-219152944 TGTAATCTCAGCTGCTCAGGAGG - Intronic
946869285 2:224071400-224071422 TCGGATCCCAGCAGCACAGGGGG - Intergenic
947184729 2:227444798-227444820 TGGAATGTCATCAGTTAAGGCGG + Intergenic
947830491 2:233137575-233137597 TGTAATGCCAGCAACTCAGGAGG - Intronic
948217477 2:236242574-236242596 TGTAATCTCAGCTACACAGGAGG - Intronic
949078359 2:242075929-242075951 TGGAATGAATACAGCACAGGAGG - Intergenic
1168901683 20:1370337-1370359 TGTATTGTCAGCAGCATGGGTGG - Intronic
1169007692 20:2222415-2222437 TGTAATCTCAGCTACACAGGAGG - Intergenic
1169164703 20:3413016-3413038 TGTAATCTCAGCAACTCAGGAGG - Intergenic
1169610797 20:7378083-7378105 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1169779369 20:9292955-9292977 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1170068420 20:12340566-12340588 TGGAATGTCATCAGTTGAGGCGG + Intergenic
1170069219 20:12345805-12345827 TGGAATGTCATCAGTTGAGGCGG + Intergenic
1170077220 20:12432791-12432813 TGGAATGTCAGCTGCAGAGATGG + Intergenic
1170106689 20:12759296-12759318 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1170148895 20:13207135-13207157 TGGCATATCTGCAGAACAGGTGG + Intergenic
1170803268 20:19607857-19607879 TGGGATGTGACCAGCAAAGGGGG - Intronic
1172150658 20:32788054-32788076 TGGAATGTCATCAGTTAAGGTGG + Intronic
1172492195 20:35348773-35348795 TGTAATCTCAGCTACACAGGAGG - Intronic
1173118509 20:40269166-40269188 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1173119312 20:40274424-40274446 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1173386498 20:42593169-42593191 TGGAATCTCAGAATCACTGGAGG + Intronic
1173979843 20:47215249-47215271 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1174076060 20:47937796-47937818 TGTAATCTCAGCAACCCAGGAGG + Intergenic
1174262181 20:49304544-49304566 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1174326654 20:49784365-49784387 TGTAATGTCAGCTACTCAGGAGG - Intergenic
1175241743 20:57554733-57554755 TGAATGGTCAGCATCACAGGGGG + Intergenic
1175469842 20:59219633-59219655 AGGAATGTCAGCAGGGCATGTGG + Intronic
1175534882 20:59702603-59702625 TGGAATGTCAGCTTCGCAGAGGG + Intronic
1176036529 20:63041675-63041697 TGTAATCCCAGCTGCACAGGAGG - Intergenic
1176190196 20:63805040-63805062 TGTAATGTCAGCTACTCAGGAGG - Intronic
1176335948 21:5600396-5600418 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1176391809 21:6220552-6220574 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1176469610 21:7095622-7095644 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1176493171 21:7477400-7477422 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1176507471 21:7660983-7661005 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1176614145 21:9014046-9014068 TGTAATGTCAGCTACACTGGAGG + Intergenic
1176711045 21:10149841-10149863 TGTAATGTCAGCTACACTGGAGG - Intergenic
1177120092 21:17127462-17127484 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1179051827 21:37895027-37895049 TGTAATGTCAGCTACTCAGGAGG - Intronic
1179387159 21:40954881-40954903 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1179388003 21:40960359-40960381 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1179656762 21:42850628-42850650 TGGGTTGTCGGCAGGACAGGGGG - Intronic
1180497965 22:15906380-15906402 TGTAATGTCAGCTACACTGGAGG - Intergenic
1181025881 22:20127432-20127454 AGGCCTGTCCGCAGCACAGGTGG + Intergenic
1181437080 22:22917321-22917343 TGGAGTGTCACCGGCACGGGGGG - Intergenic
1181711212 22:24691402-24691424 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1182016917 22:27048310-27048332 CAGAATGTCAGCAGCAAAGCTGG + Intergenic
1182114052 22:27744795-27744817 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1182312318 22:29418050-29418072 TGTAATTTCAGCTGCTCAGGAGG - Intronic
1182732726 22:32508183-32508205 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1182793748 22:32975251-32975273 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1183584617 22:38745772-38745794 TGGAATGTCTGCAGCCCATAGGG + Exonic
1183809130 22:40239079-40239101 TGTAATCTCAGCAACTCAGGAGG + Intronic
1184212631 22:43044982-43045004 TGTAATGTCAGCTACTCAGGAGG - Intronic
1184545040 22:45162222-45162244 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1184604984 22:45567492-45567514 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1184605426 22:45570997-45571019 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1184965580 22:47969723-47969745 TGTAATCTCAGCAACACAGGAGG - Intergenic
1185105799 22:48869182-48869204 TGTAACGTCAGCTGCACTGGAGG - Intergenic
1185223264 22:49639744-49639766 CGGAATGTCAGCAGGTCAGCAGG + Intronic
949461655 3:4301277-4301299 GGGAATGTCAACAGAACAAGGGG + Intronic
949936987 3:9123581-9123603 TGGAATCTCAGCTACTCAGGAGG + Intronic
950629467 3:14272657-14272679 TGGAATGTCATCAGTTAAGGCGG + Intergenic
950926117 3:16744298-16744320 TGGAATGTCATCAGTTAAGGTGG - Intergenic
950926940 3:16749731-16749753 TGGAATGTCATCAGTTAAGGTGG - Intergenic
951058804 3:18179953-18179975 TGAAATGACAGCAGAACTGGAGG - Intronic
951345509 3:21543187-21543209 TGTAATCTCAGCTACACAGGGGG + Intronic
951519247 3:23596154-23596176 TGGAATTTCAGCAGGGCATGTGG + Intergenic
951735542 3:25859218-25859240 TGGAATGTCATCAGTTAAGGTGG + Intronic
951740225 3:25913321-25913343 TATAATGTCAGCATCTCAGGAGG - Intergenic
952564665 3:34640772-34640794 TGGAATGTCATCAGTTAAGGTGG + Intergenic
952717500 3:36494814-36494836 TAGCAGGTCAGCAGCACAGCAGG + Intronic
952841573 3:37651188-37651210 TGGAAATTCAGCAGCACTGGAGG + Intronic
952894740 3:38070800-38070822 TGGAATGTCATCAGTTAAGGCGG + Intronic
952895619 3:38076605-38076627 TGGAATGTCATCAGTTAAGGTGG + Intronic
952896903 3:38083594-38083616 TGGAATGTCATCAGTTAAGGTGG + Intronic
953384666 3:42499760-42499782 AGGGATGTCAGAAGCAGAGGGGG - Intronic
953825054 3:46244686-46244708 TGGAATGTCATCAGTTAAGGCGG + Intronic
953825263 3:46246591-46246613 TGGAATGTCATCAGTTAAGGTGG + Intronic
953862491 3:46557162-46557184 TGGAATGTCATCAGTTAAGGCGG - Intronic
954703121 3:52462570-52462592 TCCAATGTCAGCAACACAAGAGG - Intronic
954796583 3:53164459-53164481 TGTAATCTCAGCTGCTCAGGAGG + Intronic
954968828 3:54634800-54634822 TGGAATGTCATCAGTTAAGGTGG + Intronic
954969625 3:54640070-54640092 TGGAATGTCATCAGTTAAGGTGG + Intronic
956358361 3:68418507-68418529 TGGAATGTCATCAGTTAAGGCGG + Intronic
956366512 3:68509261-68509283 TGAAATGTCATCAGCACATGTGG + Intronic
956696821 3:71925585-71925607 TGGAATGTCATCAGTTAAGGCGG - Intergenic
956718819 3:72100606-72100628 GGGACTGGGAGCAGCACAGGGGG - Intergenic
956730621 3:72193578-72193600 TGGAATGTGAGCAGCAGAGATGG + Intergenic
957294835 3:78323766-78323788 TGGAATGTCATCAGTTAAGGTGG - Intergenic
957554340 3:81747665-81747687 TGGAATGTCATCAGCTAAGGCGG - Intronic
958462219 3:94413022-94413044 TGGAATGTCATCAGTTAAGGCGG + Intergenic
958768317 3:98396861-98396883 TGGAATGTCATCAGTTAAGGTGG - Intergenic
959287916 3:104440227-104440249 TGGAATGTCATCAGTTAAGGCGG + Intergenic
959288734 3:104445641-104445663 TGGAATGTCATCAGTTAAGGCGG + Intergenic
959684540 3:109130181-109130203 TGTAATGCCAGCAACTCAGGAGG + Intergenic
959970083 3:112399863-112399885 TGGAATGTCATCAGTTAAGGCGG - Intergenic
959970218 3:112400726-112400748 TGGAATGTCATCAGTTAAGGCGG + Intergenic
959972633 3:112423231-112423253 TGGAATGTCATCAGTTAAGGTGG + Intergenic
960282423 3:115793798-115793820 TGGAATGTCATCAGTTAAGGTGG + Intergenic
960283227 3:115799032-115799054 TGGAATGTCATCAGTTAAGGTGG + Intergenic
960309686 3:116105656-116105678 TGGAATGTCATCAGTTAAGGCGG + Intronic
960310532 3:116111094-116111116 TGGAATGTCATCAGTTAAGGCGG + Intronic
960503568 3:118466526-118466548 TGTAATCTCAGCTACACAGGAGG - Intergenic
960532900 3:118785325-118785347 TGGGCTGTCAGCAGCAAGGGAGG - Intergenic
960686383 3:120298224-120298246 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
960962861 3:123084308-123084330 GAGAATGTCAGCAGTACACGTGG - Intronic
961164312 3:124752867-124752889 TGGAATGTCATCAGTTAAGGTGG + Intergenic
961165107 3:124758048-124758070 TGGAATGTCATCAGTTAAGGCGG + Intergenic
961256372 3:125557501-125557523 TGTAATCTCAGCTGCTCAGGAGG - Intronic
962559808 3:136593383-136593405 AGGAATGAAAACAGCACAGGAGG + Intronic
962794881 3:138841489-138841511 TGTAATCTCAGCCGCTCAGGAGG - Intergenic
963488961 3:145974668-145974690 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
963683949 3:148414356-148414378 TGGAATGTCATCAGTTAAGGTGG - Intergenic
963684764 3:148419758-148419780 TGGAATGTCATCAGTTAAGGTGG - Intergenic
963752438 3:149196921-149196943 TGGAATGTCATCAGTTAAGGTGG - Intronic
964823716 3:160802343-160802365 TGGAATGCCAGCTGAACAAGTGG + Intronic
965055880 3:163715501-163715523 TGTAATGTCAGCTACTCAGGAGG + Intergenic
965061511 3:163789867-163789889 TGGATTTTCAGCAGTTCAGGGGG - Intergenic
965625672 3:170682123-170682145 TGGAATGTCATCAGTTAAGGTGG + Intronic
965626713 3:170689172-170689194 TGGAATGTCATCAGTTAAGGTGG + Intronic
965713860 3:171581836-171581858 TGGAATGTCATCAGTTAAGGCGG - Intergenic
966066437 3:175827597-175827619 TGGAATGTCATCAGTTAAGGTGG - Intergenic
966067664 3:175835884-175835906 TGGAATGTCATCAGTTAAGGTGG - Intergenic
966104653 3:176321935-176321957 TGGAATGTCATCAGTTAAGGTGG + Intergenic
966105439 3:176327229-176327251 TGGAATGTCATCAGTTAAGGTGG + Intergenic
966183734 3:177209939-177209961 TGTAATCTCAGCTACACAGGAGG - Intergenic
966233120 3:177670996-177671018 TGGAATGTCATCAGTTAAGGTGG + Intergenic
966314571 3:178631474-178631496 AGGAATGCCAGCCGCATAGGCGG - Intronic
966557112 3:181274995-181275017 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
966963543 3:184966432-184966454 TGGGATGACAGAAGCAGAGGTGG + Intronic
967069443 3:185949920-185949942 TGGAATGTCATCAGTTAAGGTGG - Intergenic
967102893 3:186230738-186230760 TGGGAAGTGAGGAGCACAGGAGG + Intronic
967211716 3:187175821-187175843 TGGAATGTCATCAGTTAAGGTGG + Intronic
967212532 3:187181129-187181151 TGGAATGTCATCAGTTAAGGTGG + Intergenic
967624175 3:191666575-191666597 TGGAATGTCATCAGTTAAGGTGG + Intergenic
967625043 3:191672244-191672266 TGGAATGTCATCAGTTAAGGTGG + Intergenic
967873177 3:194249123-194249145 TGGAATGTGAGCAGTGCAGTGGG - Intergenic
968217390 3:196905019-196905041 TGTAATCCCAGCTGCACAGGAGG - Intronic
968682948 4:1934205-1934227 TGTAATCTCAGCTACACAGGAGG - Intronic
969034541 4:4242638-4242660 TGTAATATCAGCTGCTCAGGAGG - Intronic
969082010 4:4626369-4626391 TGTAATGTCAGCTACTCAGGAGG - Intergenic
969223741 4:5780705-5780727 TGGAAGGGCAGCAGCAAAGGAGG + Intronic
969613381 4:8238948-8238970 TGGAAAGACAGCAGCCCTGGGGG - Intronic
969653571 4:8482711-8482733 TGGAATGTCATCAGTTAAGGTGG + Intronic
969654499 4:8488575-8488597 TGGAATGTCATCAGTTAAGGTGG + Intronic
969837135 4:9850993-9851015 ATGAATGGCAGCAGCACAGCAGG - Intronic
970196845 4:13559619-13559641 TGGAATGTCAGATGAACAGATGG + Intergenic
970255900 4:14170265-14170287 TGGAATGTCATCAGTTAAGGCGG + Intergenic
970256737 4:14175842-14175864 TGGAATGTCATCAGTTAAGGCGG + Intergenic
970530313 4:16974945-16974967 TGGAATGTCATCAGTTAAGGTGG - Intergenic
970533238 4:17003587-17003609 TGGAATGTCATCAGTTAAGGCGG - Intergenic
970636040 4:18010569-18010591 TGTAATCTCAGCTGCTCAGGAGG - Intronic
970644591 4:18106083-18106105 TGTAATGCCAGCTACACAGGAGG - Intergenic
971123574 4:23727734-23727756 TGGAATGTCATCAGTTAAGGTGG + Intergenic
971180202 4:24323396-24323418 TGGAATGTCATCAGTTAAGGCGG - Intergenic
971199754 4:24501087-24501109 TGGAATGTCATCAGTCAAGGTGG - Intergenic
971200576 4:24506412-24506434 TGGAATGTCATCAGTTAAGGTGG - Intergenic
971256384 4:25017418-25017440 TGTAATGTCAGCTGCTCAGGAGG + Intronic
971618129 4:28820172-28820194 TGTAATCGCAGCAGCTCAGGAGG + Intergenic
972310613 4:37878654-37878676 TGTAATCCCAGCTGCACAGGAGG + Intergenic
973881842 4:55280664-55280686 TGGAATGTCATCAGTTAAGGTGG + Intergenic
973944827 4:55945689-55945711 TGGAATGTCATCAGTTAAGGCGG - Intergenic
974049066 4:56923564-56923586 TGTAATTTCAGCTACACAGGAGG - Intronic
974427953 4:61764565-61764587 TGGAATGTCATCAGTTAAGGTGG + Intronic
974428759 4:61769891-61769913 TGGAATGTCATCAGTTAAGGTGG + Intronic
974576807 4:63735501-63735523 TGTAATCTCAGCAACTCAGGAGG + Intergenic
975089110 4:70379485-70379507 TGTAATCCCAGCAGCTCAGGAGG + Intronic
975135173 4:70867590-70867612 TGTAATCTCAGCTACACAGGAGG - Intergenic
975846991 4:78535323-78535345 TGGAATGGCCGCAGAACAGTAGG - Intronic
975864650 4:78714159-78714181 TGGAATGTCATCAGTTAAGGTGG + Intergenic
975865477 4:78719587-78719609 TGGAATGTCATCAGTTAAGGTGG + Intergenic
975933441 4:79554282-79554304 TGGAATGTCATCAGTTAAGGTGG + Intergenic
975934245 4:79559576-79559598 TGGAATGTCATCAGTTAAGGTGG + Intergenic
976087454 4:81420908-81420930 TGGAATGTCATCAGTTAAGGTGG - Intergenic
976301334 4:83518273-83518295 TGTAATCTCAGCTGCTCAGGAGG - Intronic
976332674 4:83850367-83850389 TGGAATGTCATCAGTTAAGGTGG + Intergenic
976696165 4:87921917-87921939 TGGAATGTCATCAGTTAAGGTGG - Intergenic
976697720 4:87936234-87936256 TGGAATGTCATCAGTTAAGGTGG + Intergenic
977009861 4:91623752-91623774 TGGAATGTCATCAGTTAAGGTGG - Intergenic
977012484 4:91654919-91654941 TGGAATGTCATCAGTTAAGGTGG + Intergenic
977013325 4:91660434-91660456 TGGAATGTCATCAGTTAAGGTGG + Intergenic
977062062 4:92271808-92271830 TGGAATGTCATCAGTTAAGGTGG + Intergenic
977062952 4:92277514-92277536 TGGAATGTCATCAGTTAAGGTGG + Intergenic
977075550 4:92444520-92444542 TGGAATGTCATCAGTTAAGGTGG + Intronic
977202975 4:94138656-94138678 TGGAATCCCAGCAACTCAGGAGG + Intergenic
977206164 4:94167156-94167178 TGGAATGTCATCAGTTAAGGTGG + Intergenic
977866337 4:102032761-102032783 TGTAATGTCAGCTACTCAGGAGG + Intronic
977932798 4:102767035-102767057 TGTAATCCCAGCTGCACAGGAGG + Intergenic
978001482 4:103559340-103559362 TGGAATGTCATCAGTTAAGGCGG + Intergenic
978869886 4:113563130-113563152 TGTAATCTCAGCTGCTCAGGAGG + Intronic
979379514 4:119993778-119993800 TGGAATGTCATCAGTTAAGGTGG - Intergenic
979380383 4:119999328-119999350 TGGAATGTCATCAGTTAAGGTGG - Intergenic
979849860 4:125561936-125561958 TGGAATGTCATCAGTTAAGGTGG + Intergenic
979850689 4:125567322-125567344 TGGAATGTCATCAGTTAAGGTGG + Intergenic
979894725 4:126145482-126145504 TGGAATGTCATCAGTTAAGGCGG + Intergenic
979895475 4:126150409-126150431 TGGAATGTCATCAGTTGAGGCGG + Intergenic
980592849 4:134914357-134914379 TGGAATGTCATCAGTTAAGGCGG - Intergenic
981247537 4:142557499-142557521 TGGACTGCCAGCTGGACAGGTGG - Intronic
981524772 4:145698935-145698957 TGGAATGTCATCAGTTAAGGTGG - Intronic
981525494 4:145703168-145703190 TGGAATGTCATCAGTTAAGGTGG - Intronic
981539334 4:145832724-145832746 TGGAATGTCATCAGTTAAGGTGG - Intronic
981540166 4:145838167-145838189 TGGAATGTCATCAGTTAAGGTGG - Intronic
982190827 4:152854032-152854054 TGTAATCCCAGCTGCACAGGAGG - Intronic
982220265 4:153118587-153118609 TGTAATCTCAGCTGCCCAGGAGG - Intergenic
982535053 4:156600308-156600330 TGGAATGTCATCAGTTAAGGCGG - Intergenic
982535890 4:156605696-156605718 TGGAATGTCATCAGTTAAGGCGG - Intergenic
983360022 4:166716237-166716259 TGGAATGTCATCAGTTAAGGTGG - Intergenic
983360864 4:166721716-166721738 TGGAATGTCATCAGTTAAGGTGG - Intergenic
983414309 4:167436325-167436347 TGGAATGTCACCAGTTAAGGTGG + Intergenic
983602918 4:169549839-169549861 TGTAATCTCAGCAACTCAGGAGG - Intronic
984030487 4:174598144-174598166 TGTAATTTCAGCTGCTCAGGAGG + Intergenic
984098559 4:175461481-175461503 TGGAATGTCATCAGTTAAGGTGG + Intergenic
984099404 4:175467052-175467074 TGGAATGTCATCAGTTAAGGCGG + Intergenic
984393366 4:179166792-179166814 TGGAATGTCATCAGTTAAGGTGG + Intergenic
984620816 4:181950083-181950105 TGGAATGTCATCAGTTAAGGTGG - Intergenic
984700242 4:182814422-182814444 TGGAATGTCATCAGTTAAGGCGG - Intergenic
984700951 4:182818599-182818621 TGGAATGTCATCAGTTAAGGCGG - Intergenic
984731546 4:183073272-183073294 TGTAATGTCAGCTACCCAGGAGG - Intergenic
984966043 4:185141375-185141397 TGGAATCCCAGCAGCTCAGGAGG - Intergenic
985389438 4:189479850-189479872 TGGAATGTCATCAGTTAAGGTGG + Intergenic
985885520 5:2674687-2674709 TGAAATGTGAGCAGCACTGGGGG - Intergenic
986019576 5:3788689-3788711 TGGAATGTCATCAGTTAAGGCGG + Intergenic
986388519 5:7263692-7263714 TGGAATGTCATCAGTTAAGGTGG - Intergenic
986389324 5:7268996-7269018 TGGAATGTCATCAGTTAAGGTGG - Intergenic
986411903 5:7489158-7489180 TGGAAAGTCTGCAGCAAAGGGGG - Intronic
986919964 5:12668196-12668218 TGGAATGTCATCAGTTAAGGTGG + Intergenic
987150483 5:15034579-15034601 TGGAATGTGAGCAGGACAGGAGG + Intergenic
987203385 5:15600256-15600278 TGGATTGTCAGAACCACAGAAGG + Intronic
987333331 5:16875989-16876011 TGTAATGTCAGCTACTCAGGAGG + Intronic
987487270 5:18539093-18539115 TGGAATGTCATCAGTTAAGGTGG - Intergenic
987497684 5:18669158-18669180 TGGAATGTCATCAGTTAAGGTGG + Intergenic
987498495 5:18674464-18674486 TGGAATGTCATCAGTTAAGGTGG + Intergenic
988487336 5:31677870-31677892 TGGTAGGACAGCAGCAGAGGAGG + Intronic
988933791 5:36062917-36062939 TGTAATGTCAGCTACTCAGGAGG + Intronic
989686340 5:44091974-44091996 TGTAGTGTCAGCTGCTCAGGAGG - Intergenic
989698733 5:44236452-44236474 TGGAATGTCATCAGTTAAGGTGG - Intergenic
989717009 5:44476205-44476227 TGTAATCCCAGCTGCACAGGAGG + Intergenic
991269476 5:64762928-64762950 TGCAATCTCAGCTGCTCAGGAGG + Intronic
991689391 5:69211955-69211977 TGTAATTCCAGCACCACAGGAGG - Intergenic
992395111 5:76362738-76362760 TGGAATGTCATCAGTTAAGGCGG - Intergenic
992515740 5:77491123-77491145 TGGAATGTCATCAGTTAAGGCGG - Intronic
992787742 5:80185819-80185841 TGGAATGTCATCAGTTAAGGCGG + Intronic
993193149 5:84703867-84703889 TGGAATGTCATCAGTTAAGGTGG - Intergenic
993672543 5:90778588-90778610 TCGAGTGTCAGAAGCACAGAGGG + Exonic
993836289 5:92823854-92823876 TGGAATGTCATCAGTTAAGGCGG - Intergenic
993837126 5:92829385-92829407 TGGAATGTCATCAGTTAAGGCGG - Intergenic
994239076 5:97399267-97399289 TGGAATGTCATCAGTTAAGGTGG + Intergenic
994247064 5:97489644-97489666 TGGGATGTCAGCTGCAGCGGGGG - Intergenic
994532121 5:100984589-100984611 TGGAATGTCATCAGTTAAGGCGG + Intergenic
994553388 5:101264417-101264439 TGGAAACTCAGAAGCATAGGAGG + Intergenic
994989232 5:106978702-106978724 TGGAATGTCATCAGTTAAGGTGG - Intergenic
995122947 5:108554680-108554702 TGGAATGTCATCAGTTAAGGTGG - Intergenic
995518067 5:112974019-112974041 TGGAATGCAGGCTGCACAGGAGG - Intergenic
995611614 5:113916731-113916753 TGTAATCCCAGCAACACAGGAGG - Intergenic
995883489 5:116867952-116867974 TGGAATGTCATCAGTTAAGGCGG + Intergenic
995890546 5:116946044-116946066 TGGAATGTCATCAGTTAAGGCGG + Intergenic
996202820 5:120697901-120697923 TGGAATGTCATCAGTTAAGGTGG + Intergenic
996344464 5:122474506-122474528 TGGAATGTCATCAGTTAAGGTGG + Intergenic
996744948 5:126839644-126839666 TGGAATGTCATCAGTTAAGGTGG + Intergenic
996745897 5:126845571-126845593 TGGAATGTCATCAGTTAAGGTGG + Intergenic
997151092 5:131496082-131496104 TGCAATGCCAGCAACTCAGGTGG + Intronic
997723095 5:136096541-136096563 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
997770043 5:136545259-136545281 TGGAATGTCATCAGTTAAGGCGG + Intergenic
997770902 5:136551888-136551910 TGGAATGTCATCAGTTAAGGTGG + Intergenic
997870628 5:137502446-137502468 TGGAATGTCAGCAGGAATGATGG - Intronic
998089881 5:139359256-139359278 TGTAATGCCAGCTACACAGGAGG - Intronic
998178281 5:139915463-139915485 TGGAATGTAAGCAGGACCTGGGG - Intronic
998203268 5:140142228-140142250 TGCAATGTCAGCCTCACAAGAGG - Intergenic
998384728 5:141750236-141750258 TGAAATGTCACCAGCACTGAGGG - Intergenic
998537850 5:142951179-142951201 TGTAATCTCAGCTGCTCAGGAGG - Intronic
998832830 5:146177974-146177996 TGTAATCTCAGCAACTCAGGAGG + Intronic
998995826 5:147868700-147868722 TGGAATGTCATCAGTTAAGGTGG - Intergenic
998996728 5:147874392-147874414 TGGAATGTCATCAGTTAAGGTGG + Intronic
999265762 5:150265818-150265840 TGTAATCTCAGCTGCTCAGGAGG + Intronic
999334047 5:150700097-150700119 AGGAATGTCAGCATGATAGGAGG - Intronic
999741534 5:154558428-154558450 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1000092824 5:157945366-157945388 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1000150461 5:158495644-158495666 TGGAATGGAAGGAGCACAGTTGG - Intergenic
1000196972 5:158969178-158969200 TGTAATCTCAGCTACACAGGAGG + Intronic
1000275052 5:159726572-159726594 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1001349447 5:170944386-170944408 TGTAATCTCAGCAACTCAGGAGG - Intronic
1001933378 5:175688354-175688376 AGGAAAGGCAGCAGGACAGGGGG - Intergenic
1002800242 6:515440-515462 TAGAATGTCGGCACCACAGCAGG + Intronic
1003262678 6:4534861-4534883 TGGAATCCCAGCTGCTCAGGAGG + Intergenic
1003429732 6:6028102-6028124 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1003430561 6:6033482-6033504 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1003430898 6:6036414-6036436 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1003806391 6:9729839-9729861 TGTAATGTCAGCTACTCAGGAGG + Intronic
1003863296 6:10341392-10341414 TGTAGTGCCAGCAACACAGGAGG + Intergenic
1003907772 6:10718363-10718385 TGTAATCTCAGCCGCTCAGGAGG + Intergenic
1004200501 6:13543294-13543316 TGTAATCCCAGCTGCACAGGAGG + Intergenic
1004283924 6:14302690-14302712 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1004489730 6:16103270-16103292 TGTAATCTCAGCTACACAGGAGG + Intergenic
1004895336 6:20142569-20142591 TGTAATCTCAGCTGCTCAGGAGG - Intronic
1005014207 6:21361808-21361830 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1005015033 6:21367123-21367145 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1006412086 6:33879852-33879874 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1006445957 6:34079933-34079955 TGGAGGGTCAGGAGCAGAGGAGG - Intronic
1006823021 6:36913574-36913596 TGAAACGTCTACAGCACAGGGGG - Intronic
1007003899 6:38341838-38341860 TGTAGTGGCAGCAGCAAAGGTGG + Intronic
1007206247 6:40154045-40154067 TGGAATGTAAGATGCACAAGTGG - Intergenic
1007523947 6:42474618-42474640 TGGAATGCCAGCTACTCAGGAGG - Intergenic
1008475715 6:51933760-51933782 TGGAATGTGAGCAGAACTGGGGG - Intronic
1009705435 6:67244424-67244446 TGTAATCTCAGCTACACAGGAGG - Intergenic
1010131559 6:72499970-72499992 TGTATTCTCAGCTGCACAGGAGG + Intergenic
1010587583 6:77672659-77672681 TGTAATCTCAGCAACTCAGGAGG - Intergenic
1010739993 6:79490049-79490071 TGGAATATCAACAAGACAGGGGG + Intronic
1010893989 6:81344225-81344247 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1011467592 6:87674178-87674200 TGTAATGCCAGCAACTCAGGAGG + Intergenic
1011771219 6:90675308-90675330 TGGAATGTCATCAGTTCAGGTGG + Intergenic
1012048379 6:94307948-94307970 TGGAATCCCAGCAACTCAGGAGG - Intergenic
1012066892 6:94559476-94559498 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1012206358 6:96465569-96465591 TGAAATGTGAGCAGGAAAGGTGG - Intergenic
1012281673 6:97335384-97335406 TGTAATCTCAGCTACACAGGAGG - Intergenic
1012316259 6:97784987-97785009 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1012689161 6:102292839-102292861 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1012941714 6:105422868-105422890 TGAATTGTCAGCAGCTCAGCGGG - Intergenic
1013051788 6:106543149-106543171 TGTAATCTCAGCTACACAGGAGG - Intronic
1013233898 6:108179985-108180007 TGAAATGCCAGCAGCTCAGCAGG - Intronic
1013250308 6:108326836-108326858 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1013843268 6:114422755-114422777 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1013844094 6:114428163-114428185 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1013876996 6:114843953-114843975 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1014360549 6:120467999-120468021 TGGAATGTCATCAGCTAAGGTGG + Intergenic
1014454426 6:121620735-121620757 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1014556295 6:122845230-122845252 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1014611759 6:123556917-123556939 TGGAATGTCATCAGTTAAGGTGG - Intronic
1014718241 6:124890519-124890541 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1014719336 6:124897442-124897464 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1014802464 6:125791384-125791406 TGGATTTTCAGCAGCTCAGGTGG + Intronic
1014957628 6:127640633-127640655 AGGAGTGGCAGCAGCACAGAAGG + Intergenic
1015212274 6:130711956-130711978 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1015267181 6:131300859-131300881 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1015269283 6:131323408-131323430 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1015270086 6:131328800-131328822 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1015271801 6:131344226-131344248 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1015287611 6:131504643-131504665 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1015324269 6:131907081-131907103 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1015689691 6:135908208-135908230 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1015695086 6:135970990-135971012 TGGCATGGCAGCAGAGCAGGTGG + Intronic
1015892047 6:137979077-137979099 TGTAATCTCAGCTACACAGGAGG - Intergenic
1016248461 6:142015779-142015801 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1016249345 6:142021444-142021466 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1016518438 6:144923287-144923309 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1016562778 6:145415786-145415808 TGGAGTGTCAGCAACAAAGCTGG - Intergenic
1017055937 6:150435752-150435774 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1017083325 6:150689731-150689753 TGTAATGCCAGCTACACAGGAGG + Intronic
1017126282 6:151067443-151067465 TGGAATCCCAGCTACACAGGAGG - Intronic
1017324079 6:153127218-153127240 TGGGAAGCCAGCAGCACAGCAGG - Intronic
1017778899 6:157700958-157700980 TGGAATGTCATCAGTTAAGGTGG + Intronic
1017891983 6:158646285-158646307 TGGAATCCCAGCTGCTCAGGAGG - Intergenic
1018084880 6:160292218-160292240 TGGAATGTCACCAGTTAAGGCGG + Intergenic
1018172170 6:161151969-161151991 TAGAAGGTCAGCGGCACAGAGGG - Intronic
1018771844 6:166977320-166977342 TGTAATCTCAGCAACTCAGGGGG - Intergenic
1018898361 6:168036938-168036960 TGTAATGTCAGCTACTCAGGAGG + Intronic
1018917948 6:168149145-168149167 TGGAATCTCAGAATCACCGGGGG + Intergenic
1019736822 7:2654271-2654293 TGCAATCCCAGCTGCACAGGAGG + Intronic
1019964628 7:4488604-4488626 TGTAATCTCAGCAACTCAGGAGG + Intergenic
1020000586 7:4753510-4753532 GGGGATGTCAGCATCACAGGTGG + Intronic
1020201364 7:6082494-6082516 TGTAATCTCAGCAGTTCAGGAGG + Intergenic
1020243389 7:6412540-6412562 TGGAATCCCAGCACCTCAGGAGG - Intronic
1020532272 7:9353721-9353743 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1020533081 7:9359073-9359095 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1020540583 7:9458015-9458037 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1021810291 7:24396359-24396381 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1021811091 7:24401658-24401680 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1022061140 7:26796857-26796879 TGGATTTTCAAAAGCACAGGGGG + Intronic
1022886782 7:34654937-34654959 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1023565842 7:41522950-41522972 TGGCCTTTCAACAGCACAGGAGG - Intergenic
1023698444 7:42870922-42870944 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1023699267 7:42876270-42876292 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1023900907 7:44477953-44477975 TGTAATCTCAGCTACACAGGAGG - Intronic
1023966510 7:44965664-44965686 TGGAAGGGCTGCAGCACAGCAGG + Exonic
1024330056 7:48146590-48146612 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1024697217 7:51869962-51869984 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1024859250 7:53818609-53818631 TGGATTTTCAACTGCACAGGGGG + Intergenic
1025099276 7:56122046-56122068 TGTAATCTCAGCTGCTCAGGAGG + Intergenic
1025730546 7:64103169-64103191 TGGAGTGACAGCAGCACCGTGGG - Intronic
1025748050 7:64263211-64263233 TGTAATGTCAGCCACTCAGGAGG - Intronic
1025865454 7:65376566-65376588 TGTAATGTCAGCTACTCAGGAGG - Intronic
1026061031 7:67026327-67026349 TGTAATCCCAGCACCACAGGAGG - Intronic
1026270868 7:68835597-68835619 TGTAATGCCAGCTACACAGGAGG + Intergenic
1026574159 7:71557950-71557972 TGTAATGTCAGCCACTCAGGAGG + Intronic
1026717331 7:72801070-72801092 TGTAATCCCAGCACCACAGGAGG + Intronic
1027398673 7:77785440-77785462 TGTAATGTCAGCTACTCAGGAGG - Intergenic
1027749297 7:82121311-82121333 TGTAATCTCAGCAACTCAGGAGG - Intronic
1027851584 7:83459780-83459802 TGGAATGTCATCAGTTAAGGTGG - Intronic
1028674485 7:93442931-93442953 TGGACTTTCAGCAGCCCTGGGGG + Intronic
1029662920 7:101975127-101975149 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1030308894 7:108048812-108048834 TGTAATCTCAGCTGCTCAGGAGG - Intronic
1030442021 7:109597545-109597567 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1030446071 7:109647461-109647483 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1030509867 7:110471063-110471085 TGGAATCCCAGCTGCTCAGGAGG + Intergenic
1030826221 7:114161902-114161924 TGTAATGTCAGCTACTCAGGAGG - Intronic
1031005100 7:116460855-116460877 TGGAATGTCATCAGTTAAGGCGG - Intronic
1031089425 7:117336563-117336585 TGGAATCTCAGCTACTCAGGAGG + Intergenic
1031525184 7:122816841-122816863 TGGAATGTCATCAGTTAAGGTGG - Intronic
1031526092 7:122822663-122822685 TGGAATGTCATCAGTTAAGGTGG - Intronic
1031727473 7:125258940-125258962 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1031775958 7:125910077-125910099 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1031776757 7:125915403-125915425 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1033601895 7:142894364-142894386 TGGAGTGGCAGCAGCTGAGGGGG + Intergenic
1033734454 7:144208164-144208186 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1033748597 7:144342805-144342827 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1033799513 7:144883345-144883367 TGTAATCTCGGCAGCTCAGGAGG - Intergenic
1034126863 7:148680216-148680238 TGCAATCTCAGCAACTCAGGAGG + Intergenic
1035400814 7:158564483-158564505 TGGGATGGCAGCCGCACAGCTGG - Intronic
1035536625 8:395952-395974 TGGAATGAATACAGCACAGGAGG - Intergenic
1035584737 8:763196-763218 TGGACTATCAGCAGCGCAGCCGG + Intergenic
1035713744 8:1738380-1738402 TGGACTGTAGGCAGCAAAGGAGG + Intergenic
1035722307 8:1801409-1801431 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1035823725 8:2621993-2622015 TGGAATGCCTGCAGCATAGGAGG + Intergenic
1036407734 8:8470030-8470052 TGTAATCTCAGCACTACAGGAGG - Intergenic
1036414474 8:8534507-8534529 TGTAATCTCAGCTACACAGGAGG - Intergenic
1036934048 8:12983546-12983568 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1037164610 8:15811451-15811473 TGAAATGTCGGCAGAAAAGGTGG - Intergenic
1037564619 8:20107382-20107404 TGTAATCTCAGCTACACAGGAGG - Intergenic
1037580274 8:20241260-20241282 TATGATGTCAGCAGCACTGGAGG + Intergenic
1037592975 8:20328992-20329014 TGCAATCTCAGCTGCTCAGGAGG - Intergenic
1038792286 8:30678891-30678913 TGTAATCTCAGCACCTCAGGAGG + Exonic
1039180452 8:34860505-34860527 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1039333199 8:36561602-36561624 TGGAAGTTCAGCAGCTCAGCAGG + Intergenic
1039982320 8:42418286-42418308 TGTAATCTCAGCTGCTCAGGAGG - Intronic
1040062660 8:43117169-43117191 TGGAATGTCATCAGTTAAGGCGG + Intronic
1040565324 8:48561085-48561107 TGTAGTCTCAGCAGCTCAGGAGG - Intergenic
1041141395 8:54823450-54823472 TGTAATCCCAGCTGCACAGGAGG - Intergenic
1042066253 8:64880294-64880316 TGTAATCTCAGCTGCTCAGGCGG + Intergenic
1042252125 8:66766968-66766990 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1042345265 8:67720281-67720303 TGGAATGTCATCAGTTAAGGTGG + Intronic
1042453155 8:68973091-68973113 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1042453988 8:68978431-68978453 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1042707024 8:71675049-71675071 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1042793591 8:72635531-72635553 TGCAATCTCAGCAGCAGAGACGG - Intronic
1043184594 8:77130802-77130824 TGAAATGTCAGGCGCACAGATGG - Intergenic
1043290415 8:78593242-78593264 TGTAATCTCAGCTACACAGGAGG - Intronic
1043353227 8:79386405-79386427 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1043354007 8:79391551-79391573 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1043426367 8:80152338-80152360 TCGAATGGCAGCACCAAAGGAGG + Intronic
1043426884 8:80156685-80156707 TGGAATGTGAACATCTCAGGGGG + Intronic
1043648051 8:82548038-82548060 TGGAATCTCAGAAGCAGAGATGG + Intergenic
1043777706 8:84290619-84290641 TGGAATGTCATCAGTTAAGGTGG + Intronic
1044258183 8:90090523-90090545 TGGAATGTCATCAGTTAAGGCGG + Intronic
1044258960 8:90095734-90095756 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1044678904 8:94757529-94757551 TGTAATCTCAGCTACACAGGAGG - Intronic
1044921588 8:97175141-97175163 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1044922426 8:97180411-97180433 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1044924756 8:97200882-97200904 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1044925606 8:97206318-97206340 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1045176667 8:99732450-99732472 TGGGATGTTAGCAGCACAGCAGG - Intronic
1045197109 8:99943804-99943826 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1045197969 8:99949287-99949309 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1045991182 8:108310071-108310093 TGGAATGTCATCAGTTAAGGCGG + Intronic
1046439693 8:114241716-114241738 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1046440458 8:114246747-114246769 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1046442825 8:114281810-114281832 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1046443699 8:114287397-114287419 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1046511726 8:115212365-115212387 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1046512527 8:115217640-115217662 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1046523242 8:115352341-115352363 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1047377014 8:124309270-124309292 CAGATTTTCAGCAGCACAGGGGG + Intergenic
1047410412 8:124620065-124620087 TGTAATCTCAGCAACTCAGGAGG - Intronic
1047698977 8:127431809-127431831 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1047699797 8:127437127-127437149 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1047829097 8:128612217-128612239 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1048167999 8:132080554-132080576 TGGAATGTCATCAGTTAAGGTGG + Intronic
1048168811 8:132085868-132085890 TGGAATGTCATCAGTTAAGGTGG + Intronic
1048585818 8:135772878-135772900 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1049119805 8:140725253-140725275 TGTAATCTCAGCAACTCAGGAGG - Intronic
1049292316 8:141810934-141810956 TGGAATGTCATCAGCGGAGAGGG + Intergenic
1049685862 8:143939080-143939102 TGCCCTGTCAGCAGCACACGCGG - Intronic
1050932632 9:11349356-11349378 TGGCATGTTAACAGCACAGTCGG + Intergenic
1050937985 9:11423398-11423420 TGGAATGATATCATCACAGGAGG + Intergenic
1050939737 9:11443552-11443574 TGGCATGTTAGCAGCTCAGTTGG - Intergenic
1051052269 9:12948457-12948479 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1051053078 9:12953760-12953782 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1051849043 9:21487602-21487624 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1052654138 9:31334362-31334384 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1053339218 9:37308645-37308667 TGTAATATCAGCTGCTCAGGAGG + Intronic
1053648035 9:40135536-40135558 TGTAATGTCAGCTACACTGGAGG - Intergenic
1053757703 9:41328309-41328331 TGTAATGTCAGCTACACTGGAGG + Intergenic
1054329006 9:63733481-63733503 TGTAATGTCAGCTACACTGGAGG - Intergenic
1054536545 9:66240635-66240657 TGTAATGTCAGCTACACTGGAGG + Intergenic
1055232677 9:74085695-74085717 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1055809669 9:80137407-80137429 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1055810498 9:80142824-80142846 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1056219840 9:84440463-84440485 TGTAATCTCAGCTACACAGGAGG - Intergenic
1056323451 9:85458437-85458459 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1056324698 9:85466608-85466630 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1056522891 9:87416337-87416359 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1056882648 9:90412807-90412829 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1056883418 9:90417981-90418003 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1057234474 9:93347699-93347721 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1057235286 9:93353012-93353034 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1057683572 9:97214606-97214628 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1057818701 9:98315048-98315070 TGGAATGTCAGCAGCACAGGGGG - Intronic
1057981632 9:99669893-99669915 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1057982526 9:99675563-99675585 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1058089409 9:100787390-100787412 TGTAATCTCAGCAACTCAGGAGG + Intergenic
1058172717 9:101702178-101702200 TGTAATGTCAGCTACTCAGGTGG + Intronic
1058974667 9:110114853-110114875 TGGAATCCCAGGAGCACAGCCGG - Intronic
1059575035 9:115478582-115478604 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1059606259 9:115839494-115839516 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1059607065 9:115844795-115844817 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1059670161 9:116483724-116483746 TGGAAGGGCAGGAGCTCAGGAGG + Intronic
1059863838 9:118491263-118491285 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1060225792 9:121790114-121790136 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1060226766 9:121796432-121796454 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1060435892 9:123592759-123592781 TGGAGTGCCAGCTGCTCAGGAGG - Intronic
1060686510 9:125618873-125618895 TGGAATATCAGCACTTCAGGAGG + Intronic
1060774428 9:126361790-126361812 TGTAATCCCAGCAGCTCAGGAGG + Intronic
1061002611 9:127910780-127910802 TGGAATGTTAGCACCAGATGAGG - Intronic
1061515722 9:131088961-131088983 TGTAATCTCAGCTACACAGGAGG + Intronic
1061569193 9:131465844-131465866 TGTAATCCCAGCAGCTCAGGAGG - Intronic
1062294387 9:135816367-135816389 TGGCTGGGCAGCAGCACAGGTGG - Intronic
1202795802 9_KI270719v1_random:118830-118852 TGTAATGTCAGCTACACTGGAGG - Intergenic
1203425690 Un_GL000195v1:34506-34528 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1185857971 X:3553441-3553463 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1185858952 X:3560027-3560049 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1185961088 X:4546186-4546208 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1185990705 X:4891726-4891748 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1185991519 X:4896995-4897017 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1186232929 X:7475611-7475633 TGTAATCTCAGCTACACAGGAGG + Intergenic
1186351806 X:8747751-8747773 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1186530503 X:10290527-10290549 GGGAGTGTCAGCAGAACAGCAGG + Intergenic
1186721617 X:12310342-12310364 TGGAATGTCATCAGTTAAGGTGG + Intronic
1186724653 X:12344368-12344390 TGGAATTTGAGCAGTACTGGAGG - Intronic
1187068292 X:15862901-15862923 TGTAATCTCAGCTACACAGGAGG + Intergenic
1187238021 X:17486556-17486578 GGCAATGGCAGAAGCACAGGAGG + Intronic
1187277814 X:17831736-17831758 GGGAATGTAAGCAGCACAAAGGG + Intronic
1187386552 X:18853976-18853998 TGTAATCTCAGCTGCTCAGGAGG - Intergenic
1187890049 X:23925908-23925930 TGTAATGTCAGCTGCTCGGGAGG - Intronic
1189399791 X:40657007-40657029 TGTAATCCCAGCTGCACAGGAGG - Intronic
1189586648 X:42468721-42468743 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1189822294 X:44881807-44881829 TGTAATGTCAGCTACTCAGGAGG - Intronic
1190049610 X:47140043-47140065 TGGGATGTCACCTACACAGGAGG + Intergenic
1190705169 X:53021385-53021407 TGAAATCTCAGCTGCTCAGGCGG - Intergenic
1191161889 X:57338430-57338452 TGGAATGTCATCAGTTAAGGTGG + Intronic
1191190163 X:57658069-57658091 TGGAATATAAGCAGCACCGCAGG + Intergenic
1191762136 X:64657279-64657301 TGGAATGTCATCAGTTAAGGAGG - Intergenic
1192186374 X:68949413-68949435 GGGTGAGTCAGCAGCACAGGGGG - Intergenic
1192399272 X:70818165-70818187 TGGAATCCCAGCTACACAGGAGG + Intronic
1192431738 X:71117193-71117215 TGTAATGCCAGCTGCTCAGGAGG - Intergenic
1192550386 X:72048865-72048887 TGTAATGTCAGCTACTCAGGAGG + Intergenic
1193146774 X:78084498-78084520 TGTAATCTCAGCTGCTCAGGAGG + Intronic
1193640811 X:84007954-84007976 TGGAGTGTAAGCAGCACTAGGGG - Intergenic
1193941090 X:87681791-87681813 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1193941941 X:87687306-87687328 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1194052791 X:89092650-89092672 TGTAATGCCAGCTGCTCAGGAGG - Intergenic
1194160979 X:90452072-90452094 TGTAATTTCAGCAGTTCAGGAGG + Intergenic
1194185795 X:90773628-90773650 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1194186625 X:90779023-90779045 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1194293179 X:92100556-92100578 TGGAATGTCATCAGTTAAGGTGG + Intronic
1194293968 X:92105784-92105806 TGGAATGTCATCAGTTAAGGTGG + Intronic
1194308101 X:92273382-92273404 TGGAATGTCATCAGTTAAGGCGG + Intronic
1194308902 X:92278660-92278682 TGGAATGTCATCAGTTAAGGCGG + Intronic
1194351607 X:92829007-92829029 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1194502534 X:94699136-94699158 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1194503358 X:94704493-94704515 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1194503432 X:94704955-94704977 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1194534746 X:95092789-95092811 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1194822328 X:98524562-98524584 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1195740484 X:108060265-108060287 TGGAATGTCCACATCAAAGGAGG + Intronic
1195841102 X:109178456-109178478 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1195841938 X:109183822-109183844 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1196072692 X:111543919-111543941 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1196073528 X:111549334-111549356 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1196165141 X:112530492-112530514 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1196165987 X:112536018-112536040 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1196220522 X:113109018-113109040 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1196221344 X:113114290-113114312 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1196295136 X:113988507-113988529 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1196330440 X:114466784-114466806 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1196331276 X:114472173-114472195 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1196341268 X:114601588-114601610 TGGAATGTCATCAGTTAAGGTGG + Intronic
1196342122 X:114607108-114607130 TGGAATGTCATCAGTTAAGGTGG + Intronic
1196533110 X:116812793-116812815 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1196533903 X:116818088-116818110 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1196755869 X:119156532-119156554 CAGGATGTCAGCAGCCCAGGAGG - Intergenic
1196773419 X:119318080-119318102 TGGAATGTCATCAGTTAAGGCGG + Intergenic
1197064541 X:122222116-122222138 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1197352419 X:125394426-125394448 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1197792764 X:130271885-130271907 TGTAATCTCAGCAACTCAGGAGG - Intergenic
1198034557 X:132787767-132787789 TGTAATGCCAGCTGCTCAGGAGG + Intronic
1198071003 X:133148443-133148465 TGTAGTGCCAGCAGCTCAGGAGG + Intergenic
1198431531 X:136571532-136571554 TGTAGTCTCAGCAGCTCAGGAGG - Intergenic
1198994939 X:142563796-142563818 TGGAATGTCATCAGTTAAGGCGG - Intergenic
1199509356 X:148603064-148603086 GGTAATGTCAGCAGCACAGCTGG + Intronic
1199743112 X:150754400-150754422 TGGGAAGTCAGCAGCAGAGTGGG + Intronic
1200507269 Y:4029007-4029029 TGTAATTTCAGCAGTTCAGGAGG + Intergenic
1200532416 Y:4355709-4355731 TGGAATGTCATCAGTTAAGGTGG + Intergenic
1200533228 Y:4361099-4361121 TGGAATGTCATCAGTTAAGGAGG + Intergenic
1200610691 Y:5325101-5325123 TGGAATGTCATCAGTTAAGGTGG + Intronic
1200611479 Y:5330293-5330315 TGGAATGTCATCAGTTAAGGTGG + Intronic
1200659924 Y:5945699-5945721 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1201280987 Y:12341833-12341855 TGTAATCTCAGCTACACAGGAGG - Intergenic
1201375762 Y:13317123-13317145 TGTAATGTCAGCTACTCAGGAGG - Intronic
1201865195 Y:18645156-18645178 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1201937919 Y:19427352-19427374 TGGAATGTCATCAGTTAAGGTGG - Intergenic
1202075704 Y:21036284-21036306 TGGAATGTCATCAGTAAAAGTGG + Intergenic
1202261293 Y:22973158-22973180 AGGAATTTCACCATCACAGGTGG + Intergenic
1202414281 Y:24606899-24606921 AGGAATTTCACCATCACAGGTGG + Intergenic
1202456504 Y:25063187-25063209 AGGAATTTCACCATCACAGGTGG - Intergenic