ID: 1057818975

View in Genome Browser
Species Human (GRCh38)
Location 9:98316735-98316757
Sequence GACAATGATGTGCTCACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057818974_1057818975 -10 Left 1057818974 9:98316722-98316744 CCTTATCATGAGTGACAATGATG 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG No data
1057818973_1057818975 0 Left 1057818973 9:98316712-98316734 CCAAGAGCTGCCTTATCATGAGT 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG No data
1057818972_1057818975 11 Left 1057818972 9:98316701-98316723 CCATAAGGACACCAAGAGCTGCC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG No data
1057818971_1057818975 25 Left 1057818971 9:98316687-98316709 CCAGATAACATCAGCCATAAGGA 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057818975 Original CRISPR GACAATGATGTGCTCACTGC TGG Intronic
No off target data available for this crispr