ID: 1057819223

View in Genome Browser
Species Human (GRCh38)
Location 9:98318490-98318512
Sequence GTCCTGTGCAGGGCTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057819215_1057819223 14 Left 1057819215 9:98318453-98318475 CCCTGGACCAGACCTTGACAATC 0: 1
1: 0
2: 1
3: 13
4: 273
Right 1057819223 9:98318490-98318512 GTCCTGTGCAGGGCTGGCCAGGG No data
1057819217_1057819223 7 Left 1057819217 9:98318460-98318482 CCAGACCTTGACAATCATGTGCT 0: 1
1: 0
2: 1
3: 5
4: 103
Right 1057819223 9:98318490-98318512 GTCCTGTGCAGGGCTGGCCAGGG No data
1057819216_1057819223 13 Left 1057819216 9:98318454-98318476 CCTGGACCAGACCTTGACAATCA 0: 1
1: 0
2: 3
3: 21
4: 198
Right 1057819223 9:98318490-98318512 GTCCTGTGCAGGGCTGGCCAGGG No data
1057819218_1057819223 2 Left 1057819218 9:98318465-98318487 CCTTGACAATCATGTGCTTCTGT 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1057819223 9:98318490-98318512 GTCCTGTGCAGGGCTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057819223 Original CRISPR GTCCTGTGCAGGGCTGGCCA GGG Intronic
No off target data available for this crispr