ID: 1057819802

View in Genome Browser
Species Human (GRCh38)
Location 9:98322137-98322159
Sequence GGCCCTCTGGGCTGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057819793_1057819802 14 Left 1057819793 9:98322100-98322122 CCAGATGCAGGGGATCCTATTTG No data
Right 1057819802 9:98322137-98322159 GGCCCTCTGGGCTGGCCCAGAGG No data
1057819795_1057819802 -1 Left 1057819795 9:98322115-98322137 CCTATTTGGTCCTCTGCTTCCAG No data
Right 1057819802 9:98322137-98322159 GGCCCTCTGGGCTGGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057819802 Original CRISPR GGCCCTCTGGGCTGGCCCAG AGG Intronic