ID: 1057821145

View in Genome Browser
Species Human (GRCh38)
Location 9:98332035-98332057
Sequence CTGTCAAATGAGCTGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057821145_1057821150 -4 Left 1057821145 9:98332035-98332057 CCATCCATCAGCTCATTTGACAG 0: 1
1: 0
2: 2
3: 15
4: 171
Right 1057821150 9:98332054-98332076 ACAGTCAGCATGGGGTATGAAGG No data
1057821145_1057821152 10 Left 1057821145 9:98332035-98332057 CCATCCATCAGCTCATTTGACAG 0: 1
1: 0
2: 2
3: 15
4: 171
Right 1057821152 9:98332068-98332090 GTATGAAGGAGCCGAGCTTTGGG No data
1057821145_1057821153 11 Left 1057821145 9:98332035-98332057 CCATCCATCAGCTCATTTGACAG 0: 1
1: 0
2: 2
3: 15
4: 171
Right 1057821153 9:98332069-98332091 TATGAAGGAGCCGAGCTTTGGGG No data
1057821145_1057821154 20 Left 1057821145 9:98332035-98332057 CCATCCATCAGCTCATTTGACAG 0: 1
1: 0
2: 2
3: 15
4: 171
Right 1057821154 9:98332078-98332100 GCCGAGCTTTGGGGATTAGCAGG No data
1057821145_1057821151 9 Left 1057821145 9:98332035-98332057 CCATCCATCAGCTCATTTGACAG 0: 1
1: 0
2: 2
3: 15
4: 171
Right 1057821151 9:98332067-98332089 GGTATGAAGGAGCCGAGCTTTGG No data
1057821145_1057821156 25 Left 1057821145 9:98332035-98332057 CCATCCATCAGCTCATTTGACAG 0: 1
1: 0
2: 2
3: 15
4: 171
Right 1057821156 9:98332083-98332105 GCTTTGGGGATTAGCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057821145 Original CRISPR CTGTCAAATGAGCTGATGGA TGG (reversed) Intronic
900659423 1:3775276-3775298 CTGTAAAACAAGCGGATGGAGGG - Intronic
901163302 1:7197222-7197244 GTGTCAAATGTGAGGATGGAAGG + Intronic
905523576 1:38619234-38619256 CTGCCAACTGAGATGATGCATGG - Intergenic
907316970 1:53578488-53578510 GAGTCATATGAGCTGATGGCTGG - Intronic
908564985 1:65345159-65345181 CTTTCCACTGAACTGATGGAAGG + Intronic
911548821 1:99254832-99254854 CTATCAAAAGAGCTGAAGCAAGG - Intergenic
913098608 1:115542576-115542598 CTATTAAAGGAGCTGAAGGAAGG + Intergenic
914736006 1:150417400-150417422 CCGACAAATGAACTAATGGATGG - Intronic
915687586 1:157650178-157650200 CAGTCAAAAGCACTGATGGATGG - Intergenic
917223920 1:172761572-172761594 CTGCAGAATGAACTGATGGAGGG + Intergenic
917709046 1:177665932-177665954 CTGGCAAAAGAGCAGAGGGAAGG + Intergenic
922369137 1:224892062-224892084 GAGTCAGATGAGCAGATGGAGGG - Intergenic
1062975778 10:1681602-1681624 CTGTAAAATGAGGTGATCGCAGG + Intronic
1066528397 10:36307894-36307916 CTGTCAACTGGGCTGATTGGTGG + Intergenic
1068517431 10:58041807-58041829 GTGCCAAATGAGGAGATGGAAGG + Intergenic
1070204855 10:74247578-74247600 CTGTTAAAGGAGCTGATGGTTGG - Intronic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1071846479 10:89526156-89526178 CTGCCAAAAGAGTTGATGCATGG - Intronic
1072613306 10:97033316-97033338 CTGTAAAGTGAGGTGTTGGAAGG + Intronic
1075709465 10:124522829-124522851 CTGACAAATGAGTAGAGGGAAGG + Intronic
1077245720 11:1536867-1536889 ATGTGAAATGAGCAGAGGGAAGG + Intergenic
1077304344 11:1862346-1862368 CTGTCAGAAATGCTGATGGATGG - Intronic
1077550103 11:3196423-3196445 CTGGCATATGAGCAGCTGGACGG + Intergenic
1077977158 11:7259784-7259806 CTGTCAAATTAGCTCACAGAAGG + Intronic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1080491715 11:32771780-32771802 ATTTCAAATGAGATGATGGGAGG - Intronic
1084391824 11:68882393-68882415 CACTCAAAGGAACTGATGGATGG - Intergenic
1084678261 11:70649505-70649527 CTGGCAAATGAACTGGAGGAAGG - Intronic
1089548335 11:119248855-119248877 CTGTCCAATAAGCTCATGAAAGG + Intronic
1091227491 11:133966291-133966313 CGGGACAATGAGCTGATGGAAGG + Intergenic
1094694255 12:32801495-32801517 CTGTCAAATGTGCTGCTGGCTGG + Intronic
1095864648 12:46958068-46958090 CTGTCAAATGAAATGTTTGAAGG - Intergenic
1096021766 12:48331285-48331307 ACGTCAAATTAGCTGATTGAAGG + Intergenic
1096070091 12:48770374-48770396 CTCTCAAATGAACTGGTGGATGG - Intronic
1097042584 12:56164569-56164591 CTACCAAATGGGATGATGGATGG + Exonic
1098477057 12:70917438-70917460 CTGTAAAATAAGCAGTTGGATGG + Intronic
1098698627 12:73593018-73593040 CTGTCAAAAGAGCTCAAGGAAGG - Intergenic
1099567891 12:84276348-84276370 CTGCCAAATGGGATGCTGGAGGG - Intergenic
1107104198 13:36626009-36626031 CTGTCTAATGGGCTGATGTGAGG + Intergenic
1107826327 13:44332010-44332032 CTGACAAAGGAGGTGGTGGAGGG - Intergenic
1109782627 13:67131954-67131976 CAGTCAAATGTGCTGATGGATGG - Intronic
1110129913 13:71994683-71994705 CTGTCAAATGGGCTAATACAGGG - Intergenic
1117518609 14:56527888-56527910 CTGGCCAATGAGATGCTGGATGG + Intronic
1119527571 14:75334319-75334341 TTGTCAAATGAGCAGAAGGGCGG - Intergenic
1119866395 14:77978638-77978660 CTGTGAAATGAGAGAATGGATGG + Intergenic
1121120874 14:91375204-91375226 TTGCCAAATGAGCTAATGAAGGG + Intronic
1122289251 14:100671046-100671068 CTGTACGATGAGATGATGGATGG + Intergenic
1123666675 15:22613850-22613872 GAGTCAAATAAGGTGATGGAGGG + Intergenic
1124320517 15:28708423-28708445 GAGTCAAATAAGGTGATGGAGGG + Intronic
1124359185 15:29022559-29022581 ATGTCAAATCAGCTGGTGGGGGG - Intronic
1124481978 15:30086926-30086948 GAGTCAAATAAGGTGATGGAGGG - Intronic
1124521613 15:30410277-30410299 GAGTCAAATAAGGTGATGGAGGG + Intronic
1124537048 15:30555942-30555964 GAGTCAAATAAGGTGATGGAGGG - Intronic
1124543523 15:30607998-30608020 GAGTCAAATAAGGTGATGGAGGG - Intronic
1124755093 15:32399296-32399318 GAGTCAAATAAGGTGATGGAGGG + Intronic
1124761600 15:32451649-32451671 GAGTCAAATAAGGTGATGGAGGG + Intronic
1124777030 15:32597419-32597441 GAGTCAAATAAGGTGATGGAGGG - Intronic
1127144789 15:56013139-56013161 CTGCCATATGAGGAGATGGAAGG + Intergenic
1128060671 15:64733689-64733711 CTGTAAAATTAGATGATTGATGG + Intergenic
1128535801 15:68489319-68489341 CAAACAAATGAACTGATGGATGG + Intergenic
1130403778 15:83580400-83580422 CTGTCAAATGAGTGGCTGCAAGG + Intronic
1134212813 16:12292039-12292061 CTGTCAGATCTGCTGGTGGAGGG + Intronic
1135072813 16:19367282-19367304 CTCTCACATGAACTAATGGAGGG + Intergenic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1135658206 16:24270210-24270232 CAGTAGAATGAGGTGATGGAAGG - Intronic
1138030238 16:53554013-53554035 CTGTCAAACATGCTCATGGAAGG - Intergenic
1138766911 16:59616158-59616180 CTGCCAAATGAGGAGATGGGAGG - Intergenic
1139666506 16:68460627-68460649 CAGTGGAATGGGCTGATGGAAGG - Intergenic
1140728468 16:77834932-77834954 ATGTTAAATGAGCTGATGCTTGG + Intronic
1144220266 17:13093461-13093483 CTGTAAAATCACCAGATGGATGG - Intergenic
1145995808 17:29104222-29104244 CTGGCAAATGGGTAGATGGATGG + Intronic
1147877250 17:43630362-43630384 GTGTCATTTGAGCTGTTGGAAGG - Intergenic
1148588722 17:48799513-48799535 ATGTGAAATGAGGGGATGGAGGG - Intronic
1151758369 17:76087431-76087453 CGGTCAAAGGGGCTGAGGGAGGG + Intronic
1153334751 18:3911672-3911694 TTTTCTAATGAGCTGATTGATGG + Intronic
1155830223 18:30507666-30507688 CCTGCAAAGGAGCTGATGGAGGG - Intergenic
1158821712 18:61167092-61167114 CTGTAAAATGAGGTATTGGATGG - Intergenic
1159609299 18:70508577-70508599 CTTTCAATTGAGCTTATGGCTGG + Intergenic
1164504475 19:28848050-28848072 CTGGCAAATGAGCTGAGGTCAGG - Intergenic
1166667987 19:44692873-44692895 CTATAAAATGATCTGATGGCTGG + Intergenic
926313988 2:11696308-11696330 CTCTCGAATGAGCTGCTCGAGGG + Intronic
927693195 2:25222761-25222783 CTGTCACCTCAGCTGATGCAGGG + Intergenic
928098975 2:28423751-28423773 CTGTCAAATCAGGAGAAGGAGGG - Intergenic
928821165 2:35363583-35363605 CTGGGAACTGAGCTAATGGATGG + Intergenic
929908263 2:46065439-46065461 CGGACAAATGAGAAGATGGAAGG - Intronic
931165500 2:59743075-59743097 CTGACAAGTGAGCTTTTGGACGG - Intergenic
932010404 2:67972014-67972036 CAGTGATCTGAGCTGATGGAAGG - Intergenic
932066090 2:68562448-68562470 CTGTCAAATCAGCGGCTGGAGGG - Intronic
932376025 2:71236672-71236694 CTGTAAAATGAGCTGCTGGGAGG - Intergenic
932562510 2:72885947-72885969 ATGTCAAATGAATGGATGGATGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
936233800 2:110726129-110726151 CTCTCTAAGGAGCTGCTGGAAGG - Intergenic
941865135 2:170326579-170326601 ATGTCAATAGAGATGATGGAGGG - Intronic
943027061 2:182642769-182642791 TTCTAAAATGAGATGATGGAAGG - Intergenic
945287376 2:208096088-208096110 CTGACAAATGAGAGGAAGGATGG - Intergenic
945769261 2:214019983-214020005 CTGTCTCAAGAGCTGATTGATGG + Intronic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
946699870 2:222401657-222401679 CTGACCAATGAGCTCAGGGAAGG + Intergenic
947179967 2:227403150-227403172 ATGTCAAATAGGCTGTTGGAAGG + Intergenic
1169600547 20:7255226-7255248 CTATCAAATGAGCCCATGGCTGG + Intergenic
1170846034 20:19962672-19962694 CTGTGAATTGAGGTGAAGGAAGG + Intronic
1172014643 20:31865824-31865846 CTGGTAAATTTGCTGATGGAGGG + Intronic
1172771196 20:37383638-37383660 CTGTAAAATGAGCGTAAGGATGG - Intronic
1174982821 20:55416597-55416619 TTGTCAAAAGAACTGATTGATGG + Intergenic
1177208630 21:18042044-18042066 TTATCACATGAGCTGATGAACGG + Intronic
1178014997 21:28334954-28334976 CTATCAAATGATCTGGTGTAGGG - Intergenic
1182133217 22:27874423-27874445 CTGTCAAAGGAGGCGAAGGAGGG + Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1183075027 22:35421454-35421476 CTGTCAGGTGAGCAGATGCAGGG + Exonic
1183426803 22:37744381-37744403 CTGTCAAATGAGAATCTGGAAGG + Intronic
1183703363 22:39462368-39462390 CAGTTAAATGTGCAGATGGATGG + Intronic
1185420871 22:50733687-50733709 CTGTAAATGCAGCTGATGGATGG + Intergenic
950009616 3:9713520-9713542 CGGATGAATGAGCTGATGGATGG + Intronic
950896466 3:16456105-16456127 ATGTAAAATGAGCTGATTAAGGG + Intronic
951746772 3:25987022-25987044 CTGACCACTGAGCTGATGGACGG - Intergenic
951991155 3:28677504-28677526 CTGTCAAATGAACATATGCAAGG + Intergenic
952560308 3:34584913-34584935 CTGTCAAATGTTTTAATGGATGG + Intergenic
953606632 3:44416901-44416923 ATGTCAAAGGAGCTGCTGGAGGG + Intergenic
956105665 3:65815462-65815484 CTTTCAAGTGAGCTGGGGGAGGG - Intronic
958169246 3:89917664-89917686 CTGTCAAGTTAGCTGATGTTGGG - Intergenic
961958926 3:130833527-130833549 CTGTCAGATGACCTGATTAAAGG + Intergenic
962936627 3:140087325-140087347 CAGGCAAATGAGCTGATTAAAGG + Intronic
963141430 3:141949190-141949212 CTGTAAAATTTGCTAATGGAAGG + Intergenic
963207428 3:142651097-142651119 CTGTCAAATTAGCTCACTGAGGG - Intronic
963351472 3:144157352-144157374 CTGTAAAATGAGATGTTAGAAGG + Intergenic
964042688 3:152281669-152281691 CTGTCAATTGCTCTGTTGGATGG + Intronic
965561852 3:170069533-170069555 CTGGAAAATGAACAGATGGACGG - Intronic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
975493011 4:75009296-75009318 CTGACTCAGGAGCTGATGGAAGG - Intronic
975724083 4:77275368-77275390 CTGTCAACTCAGCTGAGGGTTGG + Intronic
976635054 4:87279195-87279217 CTTTCAAATGAGCTGAAGGCTGG - Intergenic
979267666 4:118721927-118721949 CTGTCAAATGAGCATAGTGATGG - Intergenic
981105066 4:140871528-140871550 CTGTGAACTGAGTTGATTGATGG - Intronic
981167400 4:141577679-141577701 CTGTTAAATGAGCTAGTGAATGG - Intergenic
983090138 4:163493645-163493667 CTGGAAAATGAGCTGAGTGAGGG + Intergenic
983113256 4:163780292-163780314 CTGTCAAATTAGCTTATCAAGGG + Intronic
983454182 4:167941582-167941604 TTGTCACAGGAGCTGAAGGAAGG + Intergenic
983767027 4:171497213-171497235 AGGTCAAATATGCTGATGGAAGG - Intergenic
985197041 4:187442750-187442772 CTGCCAAATGAGGAGATGGGAGG - Intergenic
986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG + Intergenic
986835061 5:11627951-11627973 CTGTCAGATGAGCTGCAGCAAGG - Intronic
986885850 5:12234631-12234653 TTTTCAAAGGAACTGATGGAGGG + Intergenic
989247043 5:39266148-39266170 CTGTAAAGTGAGCTGATCTAAGG + Intronic
990482967 5:56229443-56229465 CAGTCAAATGATCTGATCGTTGG + Intronic
992412265 5:76517776-76517798 CTGGAAAATGAGCTGTTGTAAGG + Intronic
993374985 5:87140270-87140292 TTGCCAAATTAGTTGATGGAAGG - Intergenic
995866739 5:116699688-116699710 CTATGAAATATGCTGATGGAAGG - Intergenic
998288789 5:140891823-140891845 CTGTAAAAGGACTTGATGGAAGG + Intronic
998992893 5:147838079-147838101 CAGTGAAAAGAGCTGATGGGAGG - Intergenic
1000875198 5:166628545-166628567 CTGTAGAACGAGGTGATGGAGGG - Intergenic
1001071463 5:168588750-168588772 CTGCCAGATGAGCTGTTTGAAGG + Intergenic
1002036897 5:176478028-176478050 TTGTCAAATGAAAGGATGGATGG + Intronic
1002912648 6:1502068-1502090 ATGTGAAATGAGGTGATGGGAGG + Intergenic
1003561341 6:7183362-7183384 TTGTCCAATGGGCTGATGGATGG - Intronic
1006511136 6:34521813-34521835 CTGTAAAATGGGCTGTTGCAAGG - Intronic
1007256775 6:40535223-40535245 CTGTCAAATGAGATGATGAAAGG + Intronic
1011533311 6:88348820-88348842 ATGACAAATGATCTGAGGGAGGG - Intergenic
1013929023 6:115507619-115507641 CTGTTAAAGGAAATGATGGAGGG - Intergenic
1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG + Intergenic
1018680737 6:166262954-166262976 CTGTCAAATGAGGTAATGAAAGG - Intergenic
1023355176 7:39359678-39359700 CTGTCAAATGCACTGATGAGAGG + Intronic
1027130444 7:75586671-75586693 CTGACAAATGAGCCCAGGGAGGG + Intronic
1028492054 7:91423492-91423514 GTGTCAAATTAGCTGATTTATGG - Intergenic
1028845026 7:95470778-95470800 ATTTCAAATGAGTTAATGGATGG - Intergenic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1035049684 7:155991670-155991692 CTGTCAAATGAGCAAATGAATGG - Intergenic
1035062985 7:156082749-156082771 GTATCAAATGATGTGATGGAAGG - Intergenic
1036645356 8:10608911-10608933 CTGTCCAGGGAGCTGAGGGAGGG - Exonic
1039252418 8:35681461-35681483 TTGTCAAATGAACAAATGGATGG + Intronic
1042197529 8:66244697-66244719 GTCTCTAATGAGCTGATGAAAGG - Intergenic
1042515635 8:69655731-69655753 CTGTCTAATGAGATAATGAAAGG - Intronic
1042927284 8:73978802-73978824 CTGACAAATCAGAAGATGGAAGG + Exonic
1044366984 8:91359168-91359190 CTGTCAAAAGAGTTGAGGAAAGG + Intronic
1051088305 9:13377658-13377680 ATGTCAATTGAACAGATGGACGG - Intergenic
1051864657 9:21666276-21666298 CTGTCATTTGAGCTGATGCAGGG + Intergenic
1054803419 9:69375636-69375658 CTGTAGAATGAGATGATGGCAGG - Intronic
1055448206 9:76404732-76404754 GTCTCAAATGAGCTCCTGGAAGG + Intergenic
1057821145 9:98332035-98332057 CTGTCAAATGAGCTGATGGATGG - Intronic
1060966153 9:127713331-127713353 CTGTAAAATGGGCTGAAGAAAGG + Intronic
1061506049 9:131032358-131032380 ATGGCAAATCAGCTGATGCAGGG - Intronic
1186357704 X:8804328-8804350 CTGTCAAATGAGCAGAGGACAGG + Intergenic
1186617791 X:11207834-11207856 CTGTCAAATGAGCAGAGGACGGG - Intronic
1189268802 X:39736077-39736099 TTGTCAAATGGGCTGAAGGTGGG - Intergenic
1190436007 X:50426186-50426208 CTGTAAAATGAGCTGGTACAGGG - Intronic
1192185688 X:68945370-68945392 CTGCCAAATGAGCTAATGGCTGG - Intergenic
1195142006 X:101970861-101970883 CTATCAAATGGCCTGAGGGATGG + Intergenic
1195922593 X:109998444-109998466 CAGTCAAATGAGCTGAATGTTGG - Intergenic
1197784669 X:130187914-130187936 CTCTCAAATGAGCTTATGTAGGG - Intergenic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic