ID: 1057825219

View in Genome Browser
Species Human (GRCh38)
Location 9:98368017-98368039
Sequence CTTCATGCACAGAGGGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057825219 Original CRISPR CTTCATGCACAGAGGGGATC AGG (reversed) Intronic
902663810 1:17923631-17923653 CTCCCTGCACAGCGGGCATCAGG - Intergenic
904293917 1:29505585-29505607 CTTCAGGGAGAGAGGGGATGGGG + Intergenic
905305480 1:37015072-37015094 CTTGATGCAGAGATGGGACCAGG - Intronic
908923023 1:69219422-69219444 CTTAATGCACAGAGTGGCTTTGG - Intergenic
913259225 1:116983268-116983290 CATAAGGCACAGCGGGGATCAGG + Intronic
915577150 1:156786970-156786992 CTTCAGGGACAGTGGGGATGGGG - Exonic
918177759 1:182060422-182060444 CTTCATACACACAGGGTAACTGG - Intronic
918693696 1:187514837-187514859 CTTCATACACAAATGAGATCGGG + Intergenic
920111325 1:203589320-203589342 CTCCAGGCCCAGAGTGGATCAGG - Intergenic
922004040 1:221510966-221510988 CTACATGCACATAGGGCACCTGG - Intergenic
923026164 1:230205876-230205898 CTTCATACACAGAGAGGAAACGG + Intronic
923659121 1:235943371-235943393 CCTTATGCAAAGAGGAGATCAGG + Intergenic
1064532317 10:16322982-16323004 CCTCATTCACAGAGGGAATTTGG + Intergenic
1064750076 10:18519543-18519565 CTTCTAGCAGAGAGGGGATGGGG - Intronic
1064952168 10:20865182-20865204 ATTCATGCACAGAGTGGAGAAGG - Intronic
1066638216 10:37528640-37528662 CTTCAGGGACAGTGAGGATCTGG - Intergenic
1067219341 10:44332585-44332607 ATTCAGGCAGAGAGGGGACCAGG + Intergenic
1067656978 10:48201251-48201273 TTTAATGCACAGATGGGCTCTGG - Exonic
1070637449 10:78140562-78140584 CTTCCTGGACACAGGGGATGAGG - Intergenic
1076873604 10:133205307-133205329 CTTCATGCACAGACAGCAGCTGG - Intronic
1076875702 10:133214585-133214607 GCTCAGGCACAGAGGGGATGGGG - Intronic
1077106850 11:845923-845945 CCTCATGCACACAGAGGAGCAGG - Intronic
1077405745 11:2381798-2381820 CTTCTTGCCCAGAGGGGTGCTGG - Intronic
1081020856 11:37946894-37946916 CTTCATGTACAGAGGGGCAGGGG + Intergenic
1082863101 11:57873914-57873936 CTTGAGGCACAGCGGGGATAGGG + Intergenic
1084751393 11:71206292-71206314 CTAAACGCACAGAGGAGATCCGG - Intronic
1084752260 11:71211859-71211881 AACCATGCACAGAGGAGATCTGG - Intronic
1084789436 11:71464034-71464056 CTTCCTGCAGACAGGGGAACAGG - Exonic
1085447550 11:76610803-76610825 CTTAATGCTTGGAGGGGATCAGG + Intergenic
1085535553 11:77215200-77215222 CTTTATGCCCTGAGGTGATCAGG - Exonic
1085732940 11:79014599-79014621 CTTCATGCACAGAGGCCACCAGG + Intronic
1087899298 11:103622536-103622558 ATTCCTGCACAGAGGGCATATGG - Intergenic
1088692623 11:112340876-112340898 CTACATTCAAGGAGGGGATCTGG - Intergenic
1089081082 11:115776727-115776749 CTGCCTGGACAGAGGGTATCTGG - Intergenic
1089455263 11:118622155-118622177 CCCCATGCCCAGGGGGGATCAGG - Intronic
1090094363 11:123729166-123729188 CTTCCTGCAGAGAGGAGCTCTGG - Exonic
1093105755 12:15084939-15084961 CTTTATGAAAAGAGTGGATCAGG - Intergenic
1103193978 12:119026061-119026083 CTTCAACCACAGAGGGCACCAGG - Intronic
1103505564 12:121440659-121440681 CTTCAGGCACAGAGGGGATCTGG - Intronic
1107903433 13:45040754-45040776 TTTCATGTGCAGAGGGGATGGGG + Intergenic
1108423447 13:50273756-50273778 CTTCAAGAACAGAGTGGATGTGG - Intronic
1109782109 13:67125359-67125381 CCCCATACACAGAGTGGATCTGG - Intronic
1114494105 14:23120767-23120789 AGTCATGCACAGAGAGCATCTGG - Intergenic
1115149438 14:30267474-30267496 CTTCAGGAACAGAGTGGCTCTGG - Intergenic
1115645016 14:35363185-35363207 CTTCCTGCACTGAGGGCAACAGG + Intergenic
1122156306 14:99752531-99752553 CTTCCTGCACCCAGGGGACCAGG - Intronic
1122270279 14:100565901-100565923 CTTCCTGCACAGAAGGGCACAGG - Intronic
1122903075 14:104789909-104789931 CTTCAGGGACAGAAGGGACCGGG - Intronic
1124143197 15:27095857-27095879 CTGCATGCAGAGAAGGGATCAGG - Intronic
1125429765 15:39582320-39582342 CATCAGGCACAGGGGGGATCAGG - Exonic
1127429875 15:58894490-58894512 CTTCAAGCACAGAGGTGTCCAGG - Exonic
1127473899 15:59314443-59314465 CCTCCTGCAGAGAGGGAATCAGG - Intronic
1130955159 15:88622195-88622217 CTTCAGGCAGGGAGGGGGTCTGG - Intronic
1135256628 16:20946562-20946584 TTTCATCCACAGAAGGAATCAGG + Intronic
1135424897 16:22327511-22327533 CAACATGGACAGAGGGGGTCCGG - Intronic
1140129590 16:72148803-72148825 CTTCATTGCCAAAGGGGATCTGG - Intronic
1141104671 16:81223722-81223744 CTTCATGCACACAGAGGTTAAGG - Intergenic
1147177957 17:38668530-38668552 CTCCATAGACAGAGGGGAGCGGG + Intergenic
1148775865 17:50095515-50095537 CTTCATGGACAGCGGGGACGGGG - Exonic
1149037379 17:52149934-52149956 TTTCATGCACAGAGGGAAAATGG + Intronic
1150334686 17:64321885-64321907 CTCCCTGGACACAGGGGATCTGG + Exonic
1152158380 17:78650191-78650213 CTCCCTGCACAGAAGGGCTCAGG - Intergenic
1156761177 18:40592602-40592624 ATTCATGCGCATAGGTGATCTGG + Intergenic
1157453960 18:47809729-47809751 CTTCAGGCAAAGAGAGGGTCAGG - Exonic
1157903362 18:51542588-51542610 GTTCATGCAGGGAGGGGATGGGG - Intergenic
1161296772 19:3524121-3524143 CTGTGTGCACAGAGAGGATCTGG + Intronic
1162525086 19:11202184-11202206 GTTCCTGGAGAGAGGGGATCTGG + Intronic
1163289352 19:16369343-16369365 CTTCATGCATTGAAGGGAACAGG + Intronic
1164282361 19:23780130-23780152 CTTCATACAGAGAGGAGACCTGG - Intronic
1165453520 19:35898481-35898503 CCTCATTCACAGATGGGGTCAGG + Exonic
926396664 2:12449868-12449890 CTTCAAGCATAGATGGGAGCAGG - Intergenic
927383573 2:22506820-22506842 CTGCCTGCACAGAGGTGAGCAGG - Intergenic
927509980 2:23638476-23638498 CTTCCTGCACAGAGGAGCTGAGG + Intronic
927567164 2:24123415-24123437 CTTCAGGCCCAAAGGGGATTGGG - Exonic
928216430 2:29365346-29365368 CTTGATGAACAGATGGGATTAGG + Intronic
932469607 2:71945255-71945277 CTTCATGCGCAGAGGGGAAATGG - Intergenic
933754667 2:85628838-85628860 CTTTAACCACAGAGGGGATTAGG - Intronic
937353722 2:121185134-121185156 CTTTAAGCACAGAGAGGATGTGG + Intergenic
939871059 2:147526389-147526411 CCTTATGCACAGAGAGGGTCAGG - Intergenic
942345278 2:174996496-174996518 ATTCCTGCACAGATGGGATAAGG + Intronic
947668655 2:231923134-231923156 CAGCATGCACAGAGGGGACCTGG + Intronic
948261202 2:236605727-236605749 CTTTATACAAAGAGGGGATTTGG - Intergenic
948388081 2:237593983-237594005 CCTCCTGCACAGAGGTCATCTGG + Intronic
1172435830 20:34928396-34928418 CTTCGTGCATAGAGGGGAGGCGG - Intergenic
1172992483 20:39046862-39046884 GTTCATGCACAGATGGAATTCGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1178810772 21:35879053-35879075 CTCCATGCACAGATGGCCTCAGG + Intronic
1179555561 21:42173298-42173320 CTTCAAGCTCAGAGAGGTTCCGG - Intergenic
1183263280 22:36810209-36810231 CTTTATGGTCAGAGGGGCTCTGG + Intronic
1185375954 22:50482652-50482674 CTCCAGGCACAGAGGGGTGCCGG + Exonic
950560762 3:13721021-13721043 CTTCATGTACACTGGGGCTCTGG + Intergenic
953360330 3:42290156-42290178 TTTCATTTACAGAGGTGATCAGG - Intergenic
954333318 3:49902292-49902314 CTTCCATCACTGAGGGGATCTGG - Intronic
955410811 3:58654265-58654287 CTTCAGGCACAGAGCAGACCTGG + Intronic
956894350 3:73644545-73644567 CTTCAGGCACAGATGGATTCAGG - Intergenic
962755897 3:138465220-138465242 CTTGAGGCACTGAGGGGGTCAGG + Intronic
964517458 3:157528064-157528086 TTTCATGCACTTGGGGGATCTGG + Intronic
966285765 3:178293700-178293722 CTTCAAGCCCAGATGTGATCCGG - Intergenic
966622465 3:181980645-181980667 CTGCATGCACAGAGGGGGGGGGG + Intergenic
967973014 3:195012952-195012974 CTTCAGGCTCAAAGGGGATCAGG + Intergenic
976486499 4:85611627-85611649 GTTCATGGACAGAGGGGAAGTGG - Intronic
976531816 4:86163246-86163268 CTTAGGGCACAGATGGGATCTGG - Intronic
976675553 4:87698092-87698114 CTGCAGGCACAGAGGGTATGGGG + Intergenic
980994701 4:139769260-139769282 CCTCATGCCCAGAGAGGCTCTGG + Intronic
981118651 4:141021821-141021843 CTTCAGGGACAGAGGGGCTTTGG - Intronic
981917960 4:150055632-150055654 ATTCATGCACAGAATTGATCTGG + Intergenic
982120379 4:152137553-152137575 CTCCATGAACAGAGGGGACTTGG + Intergenic
986571977 5:9175178-9175200 CTCCATGAACACACGGGATCTGG - Intronic
989081732 5:37630153-37630175 GTTCATGCACACAGTGGGTCAGG + Intronic
990288687 5:54327054-54327076 CTTCATGCATGGAGGTGATAAGG + Intergenic
991971760 5:72148315-72148337 CTCCATGAACAGAGGGGCTGAGG - Intronic
994319420 5:98374890-98374912 CTTCATTCTCAGAAGGGACCTGG - Intergenic
998717709 5:144905141-144905163 CTTTATGCAAAGTGGGAATCAGG + Intergenic
1000278372 5:159760450-159760472 CTTCAGGCACAGATGGGTTCAGG - Intergenic
1002427526 5:179185074-179185096 TTCCAAGCACAGAGGGGATGTGG + Intronic
1007418428 6:41705567-41705589 CTTCATGGACAGGGTGGATGAGG - Intronic
1009517725 6:64641215-64641237 CTTCTTGCACAGATGGCAGCAGG + Intronic
1010576349 6:77536143-77536165 CTTCCTCCAAAGAGGAGATCAGG - Intergenic
1015187586 6:130435879-130435901 CTTCATACACTGAAGGGATATGG + Intronic
1017819475 6:158038946-158038968 CTTCCTGCACACATGGGACCAGG + Intronic
1019701293 7:2476068-2476090 CTTCCTGGACAGATGGGATAGGG - Intronic
1020713527 7:11639008-11639030 GTTCAAGCACAGTGGGGATGGGG - Intronic
1022500035 7:30877011-30877033 TATCATCCAGAGAGGGGATCTGG - Intronic
1023573543 7:41599193-41599215 CTTTTTGTACAGATGGGATCGGG - Intergenic
1025832126 7:65061455-65061477 CTTCATTCACAGAGGGGAAAAGG - Intergenic
1025919806 7:65900883-65900905 CTTCATTCACAGAGGGGAAAAGG - Intronic
1029328601 7:99832061-99832083 ATTCCTGCACAGAGGAGCTCTGG - Intronic
1034641686 7:152608950-152608972 ATTCACCCACAGAGGGGATGAGG + Intergenic
1037431648 8:18819365-18819387 CTTCATGAAGGGAGGGGATGAGG + Intronic
1043569804 8:81589755-81589777 CTGCCTGCACAGAGGGGAAAAGG - Intergenic
1043761555 8:84075400-84075422 CTTCCTCCACAGAGTGGCTCTGG - Intergenic
1044267014 8:90193842-90193864 CTTCATACCCAGAGTGGATCAGG + Intergenic
1053432596 9:38052888-38052910 CTTCATGCATAAGGAGGATCTGG - Intronic
1057825219 9:98368017-98368039 CTTCATGCACAGAGGGGATCAGG - Intronic
1057991630 9:99776487-99776509 CCTCATTGACAGAGGAGATCAGG + Intergenic
1059858236 9:118425913-118425935 CTTCATACACAGAGGAAATACGG - Intergenic
1060957372 9:127652227-127652249 CTTCATGCATAGGGGGCAGCAGG - Intronic
1185969872 X:4650639-4650661 ATTTATGCATAGAGGTGATCTGG + Intergenic
1190159919 X:48024374-48024396 CTTTATGCACAAAAGGGATTTGG + Intronic
1194130566 X:90075895-90075917 CTTCATGCTTGGAGGGGATTTGG + Intergenic
1195377553 X:104242755-104242777 CTTCAGGCCCACAGGGGTTCAGG + Intergenic
1196490464 X:116259563-116259585 TTTCACTCACACAGGGGATCAGG - Intergenic
1197675012 X:129320000-129320022 CTTCATGCACAGATGACATTTGG - Intergenic
1199602051 X:149546935-149546957 CTTCATGCCCCAAAGGGATCAGG - Exonic
1199648337 X:149932549-149932571 CTTCATGCCCCAAAGGGATCAGG + Exonic
1200836162 Y:7733752-7733774 CTTCAAGAACAGAGGAGAGCGGG + Intergenic