ID: 1057826984 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:98378803-98378825 |
| Sequence | CTGCTTCTTGATATGGATCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1057826977_1057826984 | 19 | Left | 1057826977 | 9:98378761-98378783 | CCAGAAGGAGACAGGGAGGGCCT | 0: 1 1: 0 2: 7 3: 36 4: 365 |
||
| Right | 1057826984 | 9:98378803-98378825 | CTGCTTCTTGATATGGATCCTGG | No data | ||||
| 1057826981_1057826984 | -1 | Left | 1057826981 | 9:98378781-98378803 | CCTCTGGGATGCTGATAAGGTCC | 0: 1 1: 0 2: 1 3: 14 4: 125 |
||
| Right | 1057826984 | 9:98378803-98378825 | CTGCTTCTTGATATGGATCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1057826984 | Original CRISPR | CTGCTTCTTGATATGGATCC TGG | Intronic | ||
| No off target data available for this crispr | |||||