ID: 1057826984

View in Genome Browser
Species Human (GRCh38)
Location 9:98378803-98378825
Sequence CTGCTTCTTGATATGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057826977_1057826984 19 Left 1057826977 9:98378761-98378783 CCAGAAGGAGACAGGGAGGGCCT 0: 1
1: 0
2: 7
3: 36
4: 365
Right 1057826984 9:98378803-98378825 CTGCTTCTTGATATGGATCCTGG No data
1057826981_1057826984 -1 Left 1057826981 9:98378781-98378803 CCTCTGGGATGCTGATAAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 125
Right 1057826984 9:98378803-98378825 CTGCTTCTTGATATGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057826984 Original CRISPR CTGCTTCTTGATATGGATCC TGG Intronic
No off target data available for this crispr