ID: 1057827159

View in Genome Browser
Species Human (GRCh38)
Location 9:98380152-98380174
Sequence TCGTTCACAACCACCTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057827159_1057827165 8 Left 1057827159 9:98380152-98380174 CCTTGTCAGGTGGTTGTGAACGA No data
Right 1057827165 9:98380183-98380205 CCCTGGCTGAAAGCTGGCCTTGG No data
1057827159_1057827170 28 Left 1057827159 9:98380152-98380174 CCTTGTCAGGTGGTTGTGAACGA No data
Right 1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG No data
1057827159_1057827162 2 Left 1057827159 9:98380152-98380174 CCTTGTCAGGTGGTTGTGAACGA No data
Right 1057827162 9:98380177-98380199 GGCTGCCCCTGGCTGAAAGCTGG No data
1057827159_1057827161 -9 Left 1057827159 9:98380152-98380174 CCTTGTCAGGTGGTTGTGAACGA No data
Right 1057827161 9:98380166-98380188 TGTGAACGAAAGGCTGCCCCTGG No data
1057827159_1057827169 27 Left 1057827159 9:98380152-98380174 CCTTGTCAGGTGGTTGTGAACGA No data
Right 1057827169 9:98380202-98380224 TTGGTGACTCGCAGAGGCTGAGG No data
1057827159_1057827167 21 Left 1057827159 9:98380152-98380174 CCTTGTCAGGTGGTTGTGAACGA No data
Right 1057827167 9:98380196-98380218 CTGGCCTTGGTGACTCGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057827159 Original CRISPR TCGTTCACAACCACCTGACA AGG (reversed) Intronic