ID: 1057827163

View in Genome Browser
Species Human (GRCh38)
Location 9:98380182-98380204
Sequence CAAGGCCAGCTTTCAGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057827163_1057827173 10 Left 1057827163 9:98380182-98380204 CCCCTGGCTGAAAGCTGGCCTTG No data
Right 1057827173 9:98380215-98380237 GAGGCTGAGGGCACAGGCTCGGG No data
1057827163_1057827169 -3 Left 1057827163 9:98380182-98380204 CCCCTGGCTGAAAGCTGGCCTTG No data
Right 1057827169 9:98380202-98380224 TTGGTGACTCGCAGAGGCTGAGG No data
1057827163_1057827171 4 Left 1057827163 9:98380182-98380204 CCCCTGGCTGAAAGCTGGCCTTG No data
Right 1057827171 9:98380209-98380231 CTCGCAGAGGCTGAGGGCACAGG No data
1057827163_1057827174 20 Left 1057827163 9:98380182-98380204 CCCCTGGCTGAAAGCTGGCCTTG No data
Right 1057827174 9:98380225-98380247 GCACAGGCTCGGGAGTTAACAGG No data
1057827163_1057827170 -2 Left 1057827163 9:98380182-98380204 CCCCTGGCTGAAAGCTGGCCTTG No data
Right 1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG No data
1057827163_1057827167 -9 Left 1057827163 9:98380182-98380204 CCCCTGGCTGAAAGCTGGCCTTG No data
Right 1057827167 9:98380196-98380218 CTGGCCTTGGTGACTCGCAGAGG No data
1057827163_1057827172 9 Left 1057827163 9:98380182-98380204 CCCCTGGCTGAAAGCTGGCCTTG No data
Right 1057827172 9:98380214-98380236 AGAGGCTGAGGGCACAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057827163 Original CRISPR CAAGGCCAGCTTTCAGCCAG GGG (reversed) Intronic