ID: 1057827164

View in Genome Browser
Species Human (GRCh38)
Location 9:98380183-98380205
Sequence CCAAGGCCAGCTTTCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057827164_1057827174 19 Left 1057827164 9:98380183-98380205 CCCTGGCTGAAAGCTGGCCTTGG No data
Right 1057827174 9:98380225-98380247 GCACAGGCTCGGGAGTTAACAGG No data
1057827164_1057827171 3 Left 1057827164 9:98380183-98380205 CCCTGGCTGAAAGCTGGCCTTGG No data
Right 1057827171 9:98380209-98380231 CTCGCAGAGGCTGAGGGCACAGG No data
1057827164_1057827167 -10 Left 1057827164 9:98380183-98380205 CCCTGGCTGAAAGCTGGCCTTGG No data
Right 1057827167 9:98380196-98380218 CTGGCCTTGGTGACTCGCAGAGG No data
1057827164_1057827172 8 Left 1057827164 9:98380183-98380205 CCCTGGCTGAAAGCTGGCCTTGG No data
Right 1057827172 9:98380214-98380236 AGAGGCTGAGGGCACAGGCTCGG No data
1057827164_1057827170 -3 Left 1057827164 9:98380183-98380205 CCCTGGCTGAAAGCTGGCCTTGG No data
Right 1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG No data
1057827164_1057827169 -4 Left 1057827164 9:98380183-98380205 CCCTGGCTGAAAGCTGGCCTTGG No data
Right 1057827169 9:98380202-98380224 TTGGTGACTCGCAGAGGCTGAGG No data
1057827164_1057827173 9 Left 1057827164 9:98380183-98380205 CCCTGGCTGAAAGCTGGCCTTGG No data
Right 1057827173 9:98380215-98380237 GAGGCTGAGGGCACAGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057827164 Original CRISPR CCAAGGCCAGCTTTCAGCCA GGG (reversed) Intronic