ID: 1057827166

View in Genome Browser
Species Human (GRCh38)
Location 9:98380184-98380206
Sequence ACCAAGGCCAGCTTTCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057827166_1057827169 -5 Left 1057827166 9:98380184-98380206 CCTGGCTGAAAGCTGGCCTTGGT No data
Right 1057827169 9:98380202-98380224 TTGGTGACTCGCAGAGGCTGAGG No data
1057827166_1057827173 8 Left 1057827166 9:98380184-98380206 CCTGGCTGAAAGCTGGCCTTGGT No data
Right 1057827173 9:98380215-98380237 GAGGCTGAGGGCACAGGCTCGGG No data
1057827166_1057827171 2 Left 1057827166 9:98380184-98380206 CCTGGCTGAAAGCTGGCCTTGGT No data
Right 1057827171 9:98380209-98380231 CTCGCAGAGGCTGAGGGCACAGG No data
1057827166_1057827174 18 Left 1057827166 9:98380184-98380206 CCTGGCTGAAAGCTGGCCTTGGT No data
Right 1057827174 9:98380225-98380247 GCACAGGCTCGGGAGTTAACAGG No data
1057827166_1057827172 7 Left 1057827166 9:98380184-98380206 CCTGGCTGAAAGCTGGCCTTGGT No data
Right 1057827172 9:98380214-98380236 AGAGGCTGAGGGCACAGGCTCGG No data
1057827166_1057827170 -4 Left 1057827166 9:98380184-98380206 CCTGGCTGAAAGCTGGCCTTGGT No data
Right 1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057827166 Original CRISPR ACCAAGGCCAGCTTTCAGCC AGG (reversed) Intronic