ID: 1057827170

View in Genome Browser
Species Human (GRCh38)
Location 9:98380203-98380225
Sequence TGGTGACTCGCAGAGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057827164_1057827170 -3 Left 1057827164 9:98380183-98380205 CCCTGGCTGAAAGCTGGCCTTGG No data
Right 1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG No data
1057827159_1057827170 28 Left 1057827159 9:98380152-98380174 CCTTGTCAGGTGGTTGTGAACGA No data
Right 1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG No data
1057827163_1057827170 -2 Left 1057827163 9:98380182-98380204 CCCCTGGCTGAAAGCTGGCCTTG No data
Right 1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG No data
1057827166_1057827170 -4 Left 1057827166 9:98380184-98380206 CCTGGCTGAAAGCTGGCCTTGGT No data
Right 1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057827170 Original CRISPR TGGTGACTCGCAGAGGCTGA GGG Intronic