ID: 1057828098

View in Genome Browser
Species Human (GRCh38)
Location 9:98386594-98386616
Sequence TCCAGCTGCCCAGCAAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057828092_1057828098 -3 Left 1057828092 9:98386574-98386596 CCCGGAACCCTGTGGTGGCCTCC 0: 1
1: 0
2: 6
3: 24
4: 264
Right 1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG No data
1057828086_1057828098 28 Left 1057828086 9:98386543-98386565 CCAGACGCTGCATCCTTCTCTGT 0: 1
1: 0
2: 0
3: 9
4: 223
Right 1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG No data
1057828091_1057828098 0 Left 1057828091 9:98386571-98386593 CCTCCCGGAACCCTGTGGTGGCC 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG No data
1057828087_1057828098 15 Left 1057828087 9:98386556-98386578 CCTTCTCTGTCATTTCCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 353
Right 1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG No data
1057828093_1057828098 -4 Left 1057828093 9:98386575-98386597 CCGGAACCCTGTGGTGGCCTCCA 0: 1
1: 0
2: 2
3: 14
4: 188
Right 1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG No data
1057828094_1057828098 -10 Left 1057828094 9:98386581-98386603 CCCTGTGGTGGCCTCCAGCTGCC 0: 1
1: 0
2: 3
3: 30
4: 291
Right 1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057828098 Original CRISPR TCCAGCTGCCCAGCAAGCCA GGG Intronic
No off target data available for this crispr