ID: 1057828377

View in Genome Browser
Species Human (GRCh38)
Location 9:98388521-98388543
Sequence CAAAGCTCTGAGAAGGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057828373_1057828377 2 Left 1057828373 9:98388496-98388518 CCTCCACAAAGTACAGGAGTATA 0: 1
1: 0
2: 1
3: 7
4: 100
Right 1057828377 9:98388521-98388543 CAAAGCTCTGAGAAGGCCCGTGG No data
1057828374_1057828377 -1 Left 1057828374 9:98388499-98388521 CCACAAAGTACAGGAGTATATCC 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1057828377 9:98388521-98388543 CAAAGCTCTGAGAAGGCCCGTGG No data
1057828370_1057828377 11 Left 1057828370 9:98388487-98388509 CCTCCTGGACCTCCACAAAGTAC 0: 1
1: 0
2: 2
3: 40
4: 397
Right 1057828377 9:98388521-98388543 CAAAGCTCTGAGAAGGCCCGTGG No data
1057828371_1057828377 8 Left 1057828371 9:98388490-98388512 CCTGGACCTCCACAAAGTACAGG 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1057828377 9:98388521-98388543 CAAAGCTCTGAGAAGGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057828377 Original CRISPR CAAAGCTCTGAGAAGGCCCG TGG Intronic
No off target data available for this crispr