ID: 1057828967

View in Genome Browser
Species Human (GRCh38)
Location 9:98392806-98392828
Sequence ATGAGTAGACAGATGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 411}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057828967 Original CRISPR ATGAGTAGACAGATGGACAG TGG (reversed) Intronic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900643448 1:3698160-3698182 ATGGGCAGACAGATGGGCAGGGG + Intronic
900748446 1:4377461-4377483 ATGAGGAGCCACATGGACTGGGG + Intergenic
901260948 1:7870260-7870282 ATGAGGACACAGATGCACAGAGG + Intergenic
902922000 1:19671787-19671809 ATAAATAGACATATGGAGAGGGG - Intronic
903341661 1:22658744-22658766 ATGGATGGATAGATGGACAGAGG + Intronic
903341681 1:22658819-22658841 ATGGATGGACAGATGGACAGAGG + Intronic
903497405 1:23778761-23778783 ATGAGTAGACCGACGGCCCGAGG - Intronic
904014910 1:27412043-27412065 ATGAGTAAACTGAGGCACAGAGG - Intronic
904562509 1:31408264-31408286 CTGTGCAGAGAGATGGACAGAGG - Intergenic
905803185 1:40858935-40858957 GACAGCAGACAGATGGACAGGGG - Intergenic
907156539 1:52340210-52340232 AAAAGTAATCAGATGGACAGAGG + Exonic
907919763 1:58901673-58901695 ATGAGTGGACAGATGGATGATGG - Intergenic
907927829 1:58971242-58971264 ATGAGGAGACAGATGCAAAAAGG - Intergenic
907977240 1:59443946-59443968 ATGAGTCTTCAGATGGCCAGAGG + Intronic
908927552 1:69274450-69274472 AAGAGTAGACAGTGGTACAGAGG - Intergenic
909351446 1:74658088-74658110 ATGAGTTAACAGATGTAGAGTGG + Intronic
909674300 1:78221942-78221964 ATGAGGAGACAGCTGAGCAGGGG + Intergenic
911596475 1:99803748-99803770 ATGAGTAGAGAGCTGAGCAGAGG - Intergenic
912567329 1:110597469-110597491 ATGGGGAGACAGAGGGAGAGGGG + Intronic
912681928 1:111734240-111734262 AGGGGCAGACAGATGGAGAGGGG + Intronic
913134854 1:115878314-115878336 ATGAGAAAACAGAGGCACAGGGG + Intergenic
916894895 1:169151817-169151839 GGGAGGAGGCAGATGGACAGAGG - Intronic
917753672 1:178077820-178077842 ATGTGTAGACTGATAGACAAGGG + Intergenic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
919484012 1:198123811-198123833 ATGAGCAGTCAGTTGTACAGAGG - Intergenic
919701070 1:200631531-200631553 ATGAGAAGACTGAGGCACAGAGG - Intronic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
919977162 1:202620180-202620202 CTGGGCAGACAGAAGGACAGCGG - Intronic
920210734 1:204326429-204326451 ATGAGAGCACAGATAGACAGAGG + Intronic
920421475 1:205837366-205837388 AGGAGTAGAGAGAAGGCCAGTGG - Intronic
920856158 1:209663926-209663948 AGGAGGGCACAGATGGACAGAGG + Intergenic
921311946 1:213853267-213853289 ATACTTAGAGAGATGGACAGGGG - Intergenic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923144398 1:231187735-231187757 CTGGGTAGCCAGAGGGACAGCGG + Intronic
1062811541 10:470114-470136 ATATGTAGACAGATGCAGAGAGG + Intronic
1063246632 10:4227042-4227064 ATGAGTGGACTGATGGAGACTGG - Intergenic
1064555040 10:16539491-16539513 AGGACTAGACAGTCGGACAGAGG + Intergenic
1068310121 10:55264851-55264873 ATGTGAAGACAGATGGTCTGAGG + Intronic
1069294007 10:66821086-66821108 ATGAGTACACATATGTACACAGG - Intronic
1069780624 10:70953172-70953194 ATAAGCAGACAGATGGATGGGGG - Intergenic
1069914050 10:71776293-71776315 AAGAATGGACAGATGGGCAGGGG - Intronic
1072230822 10:93412743-93412765 ATGAGTAAACAAATGGGAAGGGG + Intronic
1072521939 10:96236865-96236887 ATGAGTAGACATACAGACAAAGG - Intronic
1074080570 10:110165202-110165224 ATGAGAAAACAGAGGCACAGAGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075655855 10:124160740-124160762 ATGAGAAAACAAATGCACAGAGG + Intergenic
1076552101 10:131287809-131287831 ATGAGAACACTGAGGGACAGGGG + Intronic
1077312124 11:1893557-1893579 ATGAATGGACAGAGGGAGAGAGG + Intergenic
1077357414 11:2124962-2124984 ATGAGTAGACAGATGACTGGGGG + Intergenic
1077357504 11:2125424-2125446 ATGAGTAGACAGATGACTGGGGG + Intergenic
1077357521 11:2125513-2125535 ATGAGTAGACAGATGACTGGGGG + Intergenic
1077471480 11:2762899-2762921 GTGGGCAGACAGATGAACAGTGG - Intronic
1078418247 11:11183465-11183487 ATGAGTAGAATGATGGAGACAGG - Intergenic
1079475131 11:20822127-20822149 AAGAGTAGACTGAGGGTCAGGGG + Intronic
1079844459 11:25447531-25447553 ATGAGGACACAGATACACAGAGG - Intergenic
1082085966 11:48049794-48049816 GTGGGCAGACAGATTGACAGTGG + Intronic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083016342 11:59457902-59457924 GTGAGCAGTCAGATGGAGAGTGG + Exonic
1083331662 11:61901264-61901286 AAGAGTCAACAGAGGGACAGAGG + Intronic
1084446377 11:69205866-69205888 AAGTGTAGAGACATGGACAGGGG - Intergenic
1084495248 11:69499666-69499688 CTGAGTAGACAGAGTGAAAGGGG - Intergenic
1084596970 11:70122765-70122787 AGGAGGAGACAGAGAGACAGAGG - Intronic
1084700387 11:70783078-70783100 ATGAGGACACAGAGAGACAGAGG + Intronic
1085397660 11:76215066-76215088 CTGAGAAGACACATGAACAGGGG + Intergenic
1085706818 11:78794051-78794073 ATGAGCAGACAGTTGGATGGAGG - Intronic
1087397675 11:97622287-97622309 CAGAGCTGACAGATGGACAGAGG - Intergenic
1087788249 11:102379802-102379824 ATTAGGATACAGATGCACAGAGG + Intergenic
1090521317 11:127482624-127482646 AAGAGTACACAGATGGAAAGAGG - Intergenic
1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG + Intronic
1090988876 11:131798245-131798267 AGGAGCAGACAGATGCCCAGGGG - Intronic
1091055391 11:132413451-132413473 ATGAGTATAGAGATGGAAAAAGG + Intergenic
1092000841 12:5030726-5030748 AGGAGTACACAGATGGACCTAGG + Intergenic
1092044283 12:5417911-5417933 ATTAATTGACAGATGGACAGAGG - Intergenic
1092265126 12:6975029-6975051 ATGACTGGACAGAAGGACTGTGG + Intronic
1094497970 12:31001054-31001076 AAGAGTGGTCAGAGGGACAGGGG - Intergenic
1095776496 12:46016155-46016177 ATGAGTAGACAGAGAGAATGTGG - Intergenic
1095939789 12:47718490-47718512 AAAAGTTGACAGATGGATAGAGG + Intronic
1096486433 12:51985030-51985052 ATGAGAAGACTGAGGTACAGAGG + Intronic
1098428823 12:70396625-70396647 ATGAGGAAACTGAGGGACAGAGG - Intronic
1098577133 12:72055241-72055263 AAAAGTAGACAAATGGAAAGAGG - Intronic
1098627935 12:72696466-72696488 GTGAAAAGACAGATGGGCAGAGG - Intergenic
1101799077 12:108004850-108004872 AGGAGTTGACAGGTGGACAAAGG - Intergenic
1101984310 12:109433701-109433723 AGGAGTCTACAGATGGAGAGAGG - Intronic
1101987281 12:109457482-109457504 ATAAGTAGACAGATGGATACAGG - Intronic
1104427648 12:128691418-128691440 ATGCACAGACAGATGGACAGAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1108028035 13:46199256-46199278 CTGAGTAGACAGTTGGATATAGG + Intronic
1108050287 13:46428434-46428456 TTAAGTATACAGGTGGACAGTGG + Intronic
1109268259 13:60225341-60225363 ATCAGTAGACAGATGAGCAAAGG - Intergenic
1109378187 13:61524733-61524755 ATGTGAGGACAGATGGACTGCGG - Intergenic
1109542810 13:63801750-63801772 TTAAGTATACAGGTGGACAGTGG + Intergenic
1109589806 13:64463182-64463204 GGGAGCAGACAGATGGACAGGGG - Intergenic
1109678240 13:65709596-65709618 ATGAGGAAACAGAAGCACAGAGG - Intergenic
1110868830 13:80426365-80426387 ATGAATAAAGAGGTGGACAGAGG - Intergenic
1110908790 13:80928597-80928619 ATGAAGAGAGAGAGGGACAGAGG - Intergenic
1111421999 13:88023616-88023638 ATGAGGAGACAGAGAGAAAGAGG + Intergenic
1111469869 13:88666007-88666029 ATGATTAGAGAGATGAACATAGG - Intergenic
1113126875 13:106988987-106989009 ATGACTACACAGTTGGATAGTGG - Intergenic
1113643304 13:111973689-111973711 AGGAGGAGAGAGATGGACAGAGG - Intergenic
1114638545 14:24203287-24203309 ATGAGAAGACAGATGAAGTGTGG - Intronic
1114969450 14:28006967-28006989 ATGAGGTGACAGATGGACAAAGG - Intergenic
1115014837 14:28597888-28597910 ATGAGAAGACACATGGGAAGGGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116360098 14:43983421-43983443 ATGAGTAGTCATATGGAAAAGGG + Intergenic
1116536293 14:46035266-46035288 ATGAGGAGACAGGTTGAAAGTGG - Intergenic
1117196926 14:53349749-53349771 ATGAGCAAACAGATCCACAGAGG - Intergenic
1117544005 14:56776062-56776084 AAGTGTATACAGATGGTCAGAGG - Intergenic
1117669009 14:58086857-58086879 AGGTGTAGACACATGGAAAGGGG + Intronic
1118076546 14:62305864-62305886 ATGAGAACACACATGGACACAGG - Intergenic
1118369849 14:65128764-65128786 ATGAGAAGAAAGATGGATACTGG + Intergenic
1118866593 14:69709090-69709112 AGGAGTACACAGATGGTGAGTGG + Exonic
1119010056 14:70976247-70976269 ATGAGGAAACAGATTTACAGGGG + Intronic
1119279810 14:73396256-73396278 ATGGGTAGATGGATGGATAGAGG - Intronic
1119332533 14:73805653-73805675 ATGAGAAAACTGAAGGACAGAGG + Intergenic
1120062131 14:79996572-79996594 CTGAGTAGACAAATGGAATGGGG - Intergenic
1120138309 14:80897686-80897708 AGCAGGAGAGAGATGGACAGGGG - Intronic
1120952962 14:90059950-90059972 ATGGGTTGATGGATGGACAGAGG + Intergenic
1121628133 14:95401779-95401801 ATGAGGAGACAGCTTGACATGGG + Intergenic
1124492825 15:30168564-30168586 CTGGGCAGACAGAAGGACAGTGG - Intergenic
1124750709 15:32369761-32369783 CTGGGCAGACAGAAGGACAGTGG + Intergenic
1125101812 15:35922391-35922413 ATGAGCAGACAGATGAAGAGAGG - Intergenic
1125202933 15:37117191-37117213 ATGGATAGAGAGAGGGACAGTGG - Intergenic
1125388072 15:39159476-39159498 ATGAGCAGACAGATGCCCACTGG + Intergenic
1125716066 15:41820644-41820666 ATGAGGAGACTGAAGCACAGGGG - Intronic
1127130004 15:55852614-55852636 GAGAGTAGACATAGGGACAGAGG - Intronic
1127480824 15:59375435-59375457 ATTAGTAGTCAGATTGACATGGG + Intronic
1128178040 15:65574322-65574344 ATGAGTAGCCATATGGAGACGGG - Intronic
1128608706 15:69057226-69057248 ATAAATTGACAGATGGAAAGAGG - Intronic
1128793513 15:70449515-70449537 ATGGGTGGATAGAGGGACAGAGG + Intergenic
1129392264 15:75226346-75226368 GGGAGGAGGCAGATGGACAGAGG + Intergenic
1129472130 15:75761819-75761841 GGGAGGAGGCAGATGGACAGAGG - Intergenic
1129964624 15:79723177-79723199 ATGAATAGAAACATGGACACAGG + Intergenic
1130862164 15:87900814-87900836 ATGAGAACACAGAAGGCCAGGGG - Intronic
1131026437 15:89145904-89145926 AGGAGTACACAGAAGGACACTGG - Intronic
1132720571 16:1313715-1313737 GTGAGGAGACAGATGTTCAGAGG - Intronic
1133500846 16:6365224-6365246 ATGGGTAGATGGATGGATAGAGG + Intronic
1134129406 16:11639082-11639104 ATGAGTAAACAAATGGGTAGAGG + Intergenic
1134884087 16:17774484-17774506 ATGAGAAAACAGAGGCACAGCGG - Intergenic
1134890273 16:17835413-17835435 ATGAGTAAACTGAGGCACAGAGG + Intergenic
1136103414 16:28011644-28011666 AGGAGGAGGCAGATGGACATTGG - Intronic
1136238919 16:28932486-28932508 ATGAAAAGCCAGATGGCCAGGGG - Exonic
1136296919 16:29309076-29309098 ATGGGCAGAGGGATGGACAGAGG - Intergenic
1136349870 16:29699773-29699795 AAGTGTAGCCAGATGGACAAGGG - Intergenic
1136674228 16:31885633-31885655 GTGAGGAGAGTGATGGACAGTGG + Intronic
1137425262 16:48374052-48374074 AGGAGTACACAGAGGGGCAGTGG - Intronic
1138074835 16:54031878-54031900 ATGGGCAGACAGATGGAAAGAGG + Intronic
1138330014 16:56205959-56205981 ATGAGCAGAAAGAAGGCCAGTGG + Intronic
1138734699 16:59236950-59236972 TAGATTAGACAGATGCACAGTGG + Intergenic
1138869323 16:60862508-60862530 ATTGCTAGACAGGTGGACAGGGG - Intergenic
1139219595 16:65167019-65167041 ATGAATTGATGGATGGACAGAGG - Intergenic
1139465715 16:67153020-67153042 ATGAATAGACAGGTGGGGAGTGG - Intergenic
1141020516 16:80491778-80491800 ATGATAAGAAAGATGGCCAGTGG + Intergenic
1141258112 16:82422512-82422534 ATATGTAGACAGATGGATAATGG + Intergenic
1141619874 16:85231476-85231498 ATGAATAGATGGATGGACGGAGG + Intergenic
1141832781 16:86519008-86519030 ATGAAATGACAGATGGACAGAGG + Intergenic
1149019813 17:51950248-51950270 AAGAGGAGACAGAGGGTCAGAGG - Intronic
1149625897 17:58080639-58080661 AGAAGTAGCCAGATGGAAAGGGG + Intergenic
1149917400 17:60623129-60623151 ATGAGTAAACAGATGCTAAGTGG + Intronic
1149983582 17:61330655-61330677 AGGAATAGCCAGATGGGCAGGGG - Intronic
1150291822 17:63986825-63986847 ATGAGGACACTGAGGGACAGGGG + Intergenic
1152006590 17:77686008-77686030 AGGAATAGAGAGATGGAGAGTGG - Intergenic
1152044685 17:77928154-77928176 AAGAGGACAAAGATGGACAGCGG + Intergenic
1152473650 17:80503859-80503881 ATAGGTAGACGGATGGATAGAGG + Intergenic
1153332519 18:3888481-3888503 AGGAGCAGACTGATTGACAGAGG - Intronic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1153830973 18:8922290-8922312 ATCAGGAGACAGGTGGGCAGAGG + Intergenic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1155315935 18:24569985-24570007 ACGAGAACACAGATGCACAGGGG - Intergenic
1155318621 18:24596561-24596583 ATGAGCAGATGGATGGATAGAGG - Intergenic
1155620067 18:27768238-27768260 AACAATAGACAGATGGTCAGCGG - Intergenic
1156610853 18:38722521-38722543 ATGGATAGACTGATGGACAGAGG - Intergenic
1157203801 18:45681642-45681664 GTGAGCAGAGAGATGGAGAGAGG - Intronic
1157517166 18:48318980-48319002 TTTAATAGAGAGATGGACAGAGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1160094162 18:75855968-75855990 ATGGGCAGACAGATGGATGGCGG - Intergenic
1160783053 19:886363-886385 ATGAGGAGACGGAGGGTCAGAGG - Intronic
1160960226 19:1717661-1717683 GTGAGTGGATGGATGGACAGAGG + Intergenic
1160974632 19:1786839-1786861 ATGGGTAGACAGAGGCACGGGGG + Intronic
1162085964 19:8249265-8249287 ATCGGTAGATAGATGGACAGGGG + Intronic
1162525602 19:11204378-11204400 ATGGGTAGACAGGAGCACAGTGG - Intronic
1162536110 19:11263490-11263512 ATGAGTAAACTGAGGCACAGAGG + Intergenic
1164478743 19:28595226-28595248 ATGAGTGGATAGAAGGAAAGAGG + Intergenic
1165459882 19:35938012-35938034 ATGATTAGAGAGAGGCACAGTGG - Intronic
1165726152 19:38114498-38114520 TTCAGTAGAGAGAGGGACAGGGG + Intronic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
1167997393 19:53417321-53417343 ATGAGAAGACAGATACATAGAGG - Intronic
1168007362 19:53501713-53501735 ATGAGAAGAGAGATGCATAGAGG + Intergenic
1168272410 19:55257595-55257617 AGGAGGTGACAGATGGAGAGTGG - Intronic
926541385 2:14184139-14184161 AAGATTAGATAGATGGACGGAGG + Intergenic
929368463 2:41191605-41191627 AAGACTTGACAGATGGAGAGTGG + Intergenic
929617872 2:43326621-43326643 AAGACTAGAAAGATGGCCAGTGG + Intronic
930027442 2:47037759-47037781 ATGAGGAAACAGAGGCACAGAGG + Intronic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
932298368 2:70645339-70645361 ATGAGGAGACTGAAGCACAGAGG - Intronic
932568158 2:72922398-72922420 TGGAATAGACAGATGGTCAGGGG - Intronic
932892082 2:75606149-75606171 ATGGGTGGATAGATGGACAAAGG + Intergenic
933949964 2:87320469-87320491 ATTAGTTAAGAGATGGACAGAGG - Intergenic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934100892 2:88652011-88652033 TTCAGAAGACAGATGGATAGAGG + Intergenic
934987796 2:98900157-98900179 AAGGGGAGGCAGATGGACAGAGG + Intronic
935082445 2:99811390-99811412 ATGAGTAAACTGAGGCACAGAGG + Intronic
935321040 2:101889553-101889575 TTGAGCAGATAGATGGCCAGGGG + Intronic
935546676 2:104406697-104406719 ATGACCAGAGAGAGGGACAGAGG + Intergenic
935717327 2:105950776-105950798 ATGAGAAGAGGGATGGACAGAGG - Intergenic
935936975 2:108196455-108196477 ATGAGGAAACAGAGGTACAGTGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
936330227 2:111541128-111541150 ATTAGTTAAGAGATGGACAGAGG + Intergenic
936478705 2:112865147-112865169 ATGAGGAGACACATAGAGAGAGG - Intergenic
937065820 2:119016803-119016825 ATGAATAGATAGATGGATACAGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938230300 2:129653343-129653365 ATGAGTACCCAGATGGAGGGTGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939399203 2:141669237-141669259 ATTAGTAAACAGATACACAGAGG + Intronic
941060545 2:160842401-160842423 AAGTGTAGGCAGATGGAGAGGGG + Intergenic
941158893 2:162012818-162012840 ATGAGTGGAGAGATGGGCTGGGG - Intronic
943420815 2:187667029-187667051 CTGAGGAGACAGAAAGACAGTGG - Intergenic
945039791 2:205733998-205734020 AGGAGGAGACAGAGGCACAGGGG - Intronic
945295816 2:208170428-208170450 ATCAGGAATCAGATGGACAGGGG + Intronic
947952547 2:234160712-234160734 TTGAGTAGGCAGTTGGATAGGGG + Intergenic
948554465 2:238797839-238797861 AGGAGTAAACAGATGGGTAGCGG - Intergenic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
948592504 2:239060372-239060394 TGAATTAGACAGATGGACAGAGG - Intronic
948625701 2:239266669-239266691 ATGTGGAGACAGAGGGAGAGAGG - Intronic
1169170992 20:3465076-3465098 AAAAGTAGAAAGATGGACAAAGG + Intergenic
1169298100 20:4417309-4417331 ATATGAAGACAGATGCACAGAGG + Intergenic
1170457629 20:16548189-16548211 ATGAGTAGACAGAGGCTGAGCGG - Intronic
1171289616 20:23974704-23974726 ATGGGTGGACAGATGGACAATGG - Intergenic
1172203989 20:33148968-33148990 ATGAGTAGGTAGATGGATGGAGG + Intergenic
1173240379 20:41290642-41290664 ATGAGAAAACAGATGCAGAGAGG + Intronic
1173562727 20:44017769-44017791 ATGAGAAAACAGAGGCACAGAGG + Intronic
1174421830 20:50404290-50404312 AAGAGGTGACAGATGGACAGAGG + Intergenic
1175131302 20:56791744-56791766 ATGGGTGGACAGATGGATAGAGG - Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175356894 20:58375615-58375637 CTGACTAGTCAGAAGGACAGTGG + Intergenic
1175781069 20:61682388-61682410 ATGGATAGATGGATGGACAGAGG + Intronic
1176130044 20:63492934-63492956 ATGGGTGGATGGATGGACAGAGG + Intronic
1177647761 21:23921505-23921527 ATGAGTTTACAGATTGACTGGGG - Intergenic
1181507682 22:23371423-23371445 ATGAGAAGAGAAATGGACAGAGG - Intergenic
1181637620 22:24181680-24181702 ATGGCCTGACAGATGGACAGAGG - Intronic
1182039108 22:27222529-27222551 ATGGGTGGATAGATGGAGAGTGG + Intergenic
1182331624 22:29555156-29555178 AATACTAGACAGATGGAGAGTGG - Exonic
1183148953 22:36021974-36021996 ATGAGCAGACAGATGGAGTGAGG - Intronic
1183848345 22:40562242-40562264 ATGACTACACAGAAGGGCAGAGG + Intronic
1184262019 22:43323322-43323344 GTGAGTAGATGGATGGATAGTGG - Intronic
1184410463 22:44323195-44323217 ATGGGTGGACAGATGGATGGTGG - Intergenic
1184513539 22:44946588-44946610 ACGGGTAGATGGATGGACAGTGG + Intronic
1184828435 22:46968926-46968948 ACGAGTGGACAGATGGATATGGG - Intronic
1185144082 22:49120076-49120098 GTCCGTAGACACATGGACAGGGG - Intergenic
1185293841 22:50043103-50043125 ATGGATAGACAGATAAACAGTGG + Intronic
951605966 3:24435337-24435359 ATGCGTAGGCAGAGGGACACAGG + Intronic
951716110 3:25648316-25648338 GGGAGCAGACAGATGGACAGAGG + Intronic
951995096 3:28718701-28718723 CTGAGGAGCAAGATGGACAGAGG + Intergenic
954252470 3:49378534-49378556 ATGCGTAGATAGATGGGCAGTGG - Intronic
954474783 3:50734123-50734145 ATAGGTAGACAGAGAGACAGTGG - Intronic
954623675 3:52010403-52010425 ATGGATGGACAGATGGATAGAGG - Intergenic
954784112 3:53080752-53080774 ATGAGTAAACTGAGGCACAGGGG + Intronic
955078131 3:55632988-55633010 ATAAATAGACAGGTGGACAATGG - Intronic
956031052 3:65038430-65038452 ATGAGGAGACAATTGCACAGGGG + Intergenic
956682651 3:71795717-71795739 AGGAGTAGAGAGAGGGAGAGTGG + Intergenic
957119753 3:76074513-76074535 ATGGGTAAAGAGATGGACAGAGG + Intronic
957627056 3:82666716-82666738 ATGAGGAAACAGCTGGTCAGTGG + Intergenic
958179279 3:90037223-90037245 ATTAGGACACAGATGTACAGCGG + Intergenic
958632600 3:96701827-96701849 ATGAGAGGACAGATGGTCTGAGG + Intergenic
960435128 3:117617119-117617141 AGAAGAAGACAGATGGTCAGTGG + Intergenic
961083377 3:124045102-124045124 TTGAGTTGGCAGCTGGACAGTGG + Intergenic
961438797 3:126938350-126938372 CTGAGAAGACAGATGAAGAGCGG - Intronic
961689617 3:128659387-128659409 AAGAGTATACAAATGGCCAGTGG + Intronic
962410100 3:135133413-135133435 ATGGATGGACAGATGGACAGAGG + Intronic
962657655 3:137565096-137565118 GTCAGTAGACAGAAGGATAGAGG - Intergenic
962740645 3:138360688-138360710 TTGGGTAGACAGTAGGACAGAGG - Intronic
962887376 3:139640007-139640029 ATGTGAAGACAGCTGGACTGTGG - Intronic
962930370 3:140030422-140030444 AGAAGTAGACAGAAGGAGAGTGG + Intronic
963065708 3:141262064-141262086 ATGAGTACACAGAGGAACATGGG + Intronic
964390089 3:156187605-156187627 ATGACTTGCCAGATGCACAGAGG - Intronic
964769536 3:160210033-160210055 ATGAGGAGAGAGAGGGAGAGAGG - Intergenic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
966366290 3:179191153-179191175 ATGAAGAGACAGAGGTACAGGGG + Intronic
966427739 3:179798427-179798449 AGGAGGAGACAGAGGGATAGGGG - Exonic
967686368 3:192421220-192421242 ATGAGTAAATTGATGTACAGAGG - Intronic
967926519 3:194653208-194653230 ATGAGTTGTAAGATGGACAGAGG + Intronic
968449951 4:670693-670715 ACAGGTAGACAGATGGACACAGG + Exonic
968771169 4:2508304-2508326 ATGAGTTGAGAGATGGATAGAGG - Intronic
968993880 4:3933268-3933290 ATGAGTAGCAAAATGGACATTGG + Intergenic
969499272 4:7543280-7543302 ATGAGTCAACAGATGAACGGAGG - Intronic
969834355 4:9827915-9827937 ATGAGGAAACAGATGCTCAGTGG - Intronic
970184376 4:13434161-13434183 AAGAGGAGACAGATGGAGTGGGG + Intronic
970278502 4:14427713-14427735 ATGGCTGGAGAGATGGACAGTGG - Intergenic
970719372 4:18968328-18968350 ATGTGTACTCACATGGACAGCGG - Intergenic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972537016 4:40008262-40008284 ATGGGTAGCCAGAAAGACAGTGG + Intergenic
973017162 4:45154791-45154813 ATGAATGGAAATATGGACAGAGG - Intergenic
973073813 4:45898216-45898238 ATGAGTAGACAGAGTTACATTGG - Intergenic
973825932 4:54707890-54707912 AAGAGGAGACAGAGGTACAGAGG + Intronic
974883260 4:67785334-67785356 ATGAGAAGACAGAGGGTCAAAGG - Intergenic
975564248 4:75737193-75737215 ATGAGGAAACAGAGGCACAGTGG - Intronic
976727419 4:88228248-88228270 AGGAGTAGACAGCCGGACTGAGG + Intronic
979491855 4:121337282-121337304 ATGAGTCCACAGATAGACACTGG - Intronic
979819112 4:125149005-125149027 AGGAGCAGACAGATTCACAGAGG - Intergenic
980461990 4:133126182-133126204 ATGAGGATACAGATGGAAACAGG + Intergenic
980697434 4:136377839-136377861 ATGCGTATAAAGATGGATAGTGG - Intergenic
980892273 4:138828851-138828873 ATGAGCAGACAGAAGCAAAGAGG - Intergenic
981264458 4:142765497-142765519 ATCAGTAGACAGGTGGAAGGTGG + Intronic
983004110 4:162461322-162461344 GTGAGTAGAAAGATGGAAAAGGG + Intergenic
983075895 4:163326251-163326273 ATGTGTAGACAAATGTAAAGGGG + Exonic
984121824 4:175754942-175754964 GGGAGTAGACAGAGGGAGAGAGG - Intronic
984330365 4:178307586-178307608 ATGAATAGATAAATGGAAAGAGG + Intergenic
984688345 4:182696971-182696993 ATGAGTAAACTGAGGCACAGGGG - Intronic
986057736 5:4155129-4155151 ATGAGCAGAGAGAGGGACAAGGG - Intergenic
988695192 5:33614850-33614872 ATGAGTAAACACATGGAAAGTGG + Intronic
990372296 5:55132498-55132520 CTGAGAAGACAGATTGGCAGAGG - Intronic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990802836 5:59624580-59624602 CTGAGCAGACTGATGCACAGAGG + Intronic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992693992 5:79266127-79266149 AAGACTACACACATGGACAGAGG - Intronic
993441708 5:87964501-87964523 ATGCGTTTACAGAGGGACAGAGG - Intergenic
993514364 5:88812296-88812318 ATGAATAGATATATGGACAGAGG + Intronic
993964019 5:94337922-94337944 CTGGGTAGACAGAAGAACAGAGG + Intronic
994717257 5:103336448-103336470 CTGAGATGACAGTTGGACAGTGG - Intergenic
995331498 5:110952286-110952308 ATGTTTAGGAAGATGGACAGAGG - Intergenic
995981923 5:118114463-118114485 ATGGGGAAACAGATGCACAGAGG - Intergenic
996529458 5:124512387-124512409 ATCAGAAGACAGAAGGAGAGAGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997125447 5:131222371-131222393 ATGAGGAAACTGAGGGACAGAGG - Intergenic
997657278 5:135564635-135564657 ATGGGCAGACACATGGAGAGAGG + Intergenic
997718341 5:136058561-136058583 AAGAGTAGACAGCTGTACTGTGG - Intronic
999629073 5:153551452-153551474 ATGAGCAGAAAAATGGAGAGTGG - Intronic
999921392 5:156325482-156325504 ATGAGGAAACAGATCGAGAGAGG + Intronic
1000240943 5:159407524-159407546 ATGGGTTGAGAGATGGATAGAGG - Intergenic
1001006513 5:168055800-168055822 ATGAGTAGACAGACTCAGAGAGG + Intronic
1002845698 6:942511-942533 ATGAGGAGACTGAGGCACAGAGG + Intergenic
1003283236 6:4712194-4712216 TTGAGTAGACAGGCTGACAGGGG + Intronic
1004157865 6:13186242-13186264 ATAGACAGACAGATGGACAGTGG - Intronic
1004164769 6:13247180-13247202 ATAGGTAGACAGATAAACAGTGG + Intronic
1004463542 6:15862018-15862040 GCGAGTGGACAGGTGGACAGGGG + Intergenic
1004473144 6:15946918-15946940 ATGGGAGGACAGATGGACTGTGG + Intergenic
1004526603 6:16414792-16414814 TTGAGTAGAAAGAAGGACAAAGG - Intronic
1005982598 6:30847866-30847888 ATTAGTAGCCAGTTGGTCAGAGG - Intergenic
1006192742 6:32219697-32219719 CTGTGTAGCCAGGTGGACAGAGG + Exonic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1007376977 6:41463575-41463597 CTGAGTGGGCAGATGAACAGAGG + Intergenic
1007387108 6:41527719-41527741 ATGTGTAGACAGGTGGAAACAGG + Intergenic
1007811006 6:44485652-44485674 ACAGGGAGACAGATGGACAGGGG + Intergenic
1008769142 6:54958083-54958105 ATGTGTAGACAGGGGCACAGTGG - Intergenic
1010846621 6:80717042-80717064 GTGGGTAGTCAGAAGGACAGAGG - Intergenic
1010950245 6:82028076-82028098 ATCAGCACTCAGATGGACAGTGG - Intergenic
1011813979 6:91166723-91166745 ATGAGGAGACAGATGTAAAAAGG - Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012588712 6:100952939-100952961 ATGAGAAGAAAAGTGGACAGAGG - Intergenic
1012717280 6:102691574-102691596 AGGACTAGACAGATTCACAGTGG - Intergenic
1013498733 6:110725531-110725553 ATCAGTAGACAGAGAGAGAGGGG + Intronic
1014856070 6:126402328-126402350 AGGAGAAGAAAGATGGAGAGGGG - Intergenic
1014905931 6:127027153-127027175 ATGAGTAAACAGAAAGACATAGG + Intergenic
1016272626 6:142306216-142306238 AGGAGTAGAGAGATGGAAAGTGG + Intronic
1016317704 6:142808506-142808528 ATGAATAGACAGAGGGAAGGAGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017760803 6:157566680-157566702 ATGGGCAGAGAGGTGGACAGTGG - Intronic
1017935876 6:159004459-159004481 TTGAGTAGACAGTTGGACATGGG + Intergenic
1020410871 7:7890137-7890159 AAGAATGGACAAATGGACAGGGG + Intronic
1021248527 7:18294773-18294795 AAGAGTAGACACATGGAAATAGG + Intronic
1022039555 7:26567193-26567215 TTGAGTAGACAGTTGTACAGTGG - Intergenic
1022503500 7:30896819-30896841 AGGATTTGACAGATGGACATGGG - Intergenic
1022740967 7:33121333-33121355 AGAGGTAGACAGAGGGACAGGGG - Intergenic
1022916398 7:34958909-34958931 CCCAGTAGACAGATGGGCAGTGG - Intronic
1023118976 7:36890393-36890415 TTCAGCAGAGAGATGGACAGTGG - Intronic
1023133576 7:37028124-37028146 ATGAGAAAACAGAGGCACAGAGG + Intronic
1023275120 7:38510584-38510606 ATGAGAAAACAGAGGCACAGAGG + Intronic
1023724797 7:43131878-43131900 AGGAGGAGACAGAAGGACAAAGG - Intronic
1024522743 7:50320611-50320633 ATAAGTAGAAAGTAGGACAGAGG - Intronic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026275176 7:68870158-68870180 GTGAGTAGATAGATGGGTAGAGG + Intergenic
1026275413 7:68871851-68871873 GTGAGTAGATAGATGGATGGAGG - Intergenic
1026540728 7:71277720-71277742 GTGAGTAGACAGCTGTCCAGAGG + Intronic
1026715471 7:72785572-72785594 ATGAGAAAACAGAAGCACAGAGG + Intronic
1027258346 7:76445574-76445596 ATAAGTAAACAGATTGTCAGGGG - Intergenic
1027280504 7:76606444-76606466 ATAAGTAAACAGATTGTCAGGGG + Intergenic
1028729606 7:94130739-94130761 CAGAGAAGACAGAGGGACAGAGG - Intergenic
1030058509 7:105603813-105603835 AGGGGCAGAGAGATGGACAGAGG - Intergenic
1030083009 7:105793557-105793579 ATGTGTACACATGTGGACAGAGG + Intronic
1030942453 7:115670977-115670999 AAGAGAAGATAGAGGGACAGGGG + Intergenic
1030961290 7:115926762-115926784 ATGAGGAGACTGATGCACAGAGG + Intergenic
1031161198 7:118170694-118170716 ATAAGTAGAGTGATGGACAAAGG - Intergenic
1035272228 7:157727231-157727253 ATCTGTGGACGGATGGACAGAGG + Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1035647963 8:1242908-1242930 ATGGATGGACAGATAGACAGTGG + Intergenic
1036514338 8:9429910-9429932 CTGAGTAGACAGAATTACAGGGG + Intergenic
1037424978 8:18745968-18745990 ATGCCTAGACAGACAGACAGAGG + Intronic
1037921273 8:22807907-22807929 ATGAATGGATAGGTGGACAGAGG - Intronic
1038286049 8:26207254-26207276 ATCCATAGCCAGATGGACAGTGG - Intergenic
1040557826 8:48496656-48496678 AGGTGTAGCCAGATGGAGAGAGG + Intergenic
1041814756 8:61957453-61957475 GTGAATAGACAGATCTACAGAGG + Intergenic
1043506332 8:80906839-80906861 ATGAGGAGAAAGATGGGAAGGGG - Intergenic
1043510939 8:80949589-80949611 TTGTGCAGGCAGATGGACAGGGG + Intergenic
1043573978 8:81635854-81635876 ATGTGCATACATATGGACAGAGG + Intergenic
1043607497 8:82020065-82020087 ATGAAAAGAAATATGGACAGTGG - Intergenic
1045017657 8:98012862-98012884 ATGAGAAAACTGATGGTCAGAGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045242636 8:100415972-100415994 GTGAGTAGACACAGGGAAAGTGG - Intergenic
1045803473 8:106128549-106128571 ATGAGTAAACAGAGACACAGAGG - Intergenic
1046935944 8:119885835-119885857 ATTAATTGACAGATGGATAGAGG - Intronic
1047646260 8:126873748-126873770 AGGAGTAAGCAGGTGGACAGCGG + Intergenic
1048463731 8:134644245-134644267 ATGACTAAAGAGATGGAAAGGGG + Intronic
1048529687 8:135236035-135236057 TTGAGGGGACAGTTGGACAGAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049447831 8:142639513-142639535 ATGGGTGGACAGACAGACAGGGG + Intergenic
1050248798 9:3721215-3721237 ATGAGAAGACAGATGGAGTGGGG - Intergenic
1050984286 9:12062318-12062340 ATGGGTAGACAGATGAAGAGAGG - Intergenic
1051183452 9:14435460-14435482 ATGAGAAAACAGAGGCACAGAGG - Intergenic
1053188407 9:36037849-36037871 ATGAGTGCACAGAGGGAGAGAGG + Intronic
1053215777 9:36269305-36269327 ATGAGTACGCAGAGGGGCAGGGG - Intronic
1053431068 9:38042165-38042187 ATGAGGAGACAGGGGCACAGAGG - Intronic
1055985318 9:82053164-82053186 ATGAGCAGATAGATGGACTTGGG + Intergenic
1056233595 9:84570619-84570641 CTGAGCAAACAGATGGCCAGAGG - Intergenic
1057828967 9:98392806-98392828 ATGAGTAGACAGATGGACAGTGG - Intronic
1058052621 9:100422083-100422105 ATCAGTAAACAGAGGGAGAGTGG + Intergenic
1058165324 9:101612337-101612359 ATGAGTAACTAGATGGCCAGAGG + Intronic
1058570649 9:106339294-106339316 ATGAGGAGACAGAAGCTCAGTGG + Intergenic
1058916235 9:109568568-109568590 ATGAGTGCACAGATGCACATGGG - Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059622366 9:116021103-116021125 ATGAGGAGACAGTTGAAGAGAGG + Intergenic
1059689743 9:116673608-116673630 ATGCGTAGACATATACACAGAGG + Intronic
1060985698 9:127817874-127817896 ATGGATGGATAGATGGACAGTGG + Intronic
1062100628 9:134726560-134726582 ATGAGTGGACAGACGGATGGAGG + Intronic
1062112300 9:134788765-134788787 ATGAGTAGACAGGTGGATGGTGG + Intronic
1062172270 9:135141566-135141588 ATGAGTGGACAGATGGATGATGG + Intergenic
1185497528 X:566566-566588 ATGAGTAGATGGATGGATGGTGG + Intergenic
1185802515 X:3026718-3026740 GTGAGTAGAAAAATGGCCAGAGG - Intronic
1188734343 X:33694116-33694138 ATGATTAGGTAGATGGATAGGGG - Intergenic
1188833272 X:34927546-34927568 ATGAGAAGACAGGGGGGCAGGGG + Intergenic
1189214943 X:39314849-39314871 AGGAGTGGACAGATGGAGAAAGG - Intergenic
1189748382 X:44193704-44193726 GTGTGTAGACAGAGGGAGAGTGG + Intronic
1189966224 X:46376607-46376629 ATGAGGAGACAGAGGCACTGAGG + Intergenic
1189976577 X:46466435-46466457 AGGAATTGGCAGATGGACAGGGG - Intronic
1190219072 X:48499355-48499377 ATGGATGGACAGATGGACAGTGG + Intergenic
1190475568 X:50823813-50823835 ATAAGTGGACAGAAGGACACAGG - Intergenic
1194858739 X:98967766-98967788 ATGAGCAGGCAGATGGAGAGTGG - Intergenic
1195283334 X:103358069-103358091 ATAAGTAGAAATATGGACAAAGG - Exonic
1195551848 X:106180435-106180457 AGGAGTAGGAAGATGGACAATGG - Intronic
1195885328 X:109631314-109631336 ATGAATAGACAAATAGATAGAGG - Intronic
1196043057 X:111226677-111226699 ATGAGTACACTGCTGGAAAGAGG + Intronic
1196184433 X:112730916-112730938 ATGAGAAGACAAGTGGACTGAGG + Intergenic
1196349317 X:114706507-114706529 ATGAGAACACACATGGACACAGG + Intronic
1198227143 X:134655909-134655931 ATAAGGAGAAAGAAGGACAGCGG - Intronic
1199516545 X:148683035-148683057 CTGAGTAGAGAGATCAACAGAGG + Intronic
1199955946 X:152742524-152742546 ATGAGGAGACAGGTGTACTGGGG - Intergenic
1200215351 X:154365819-154365841 GTGAGGAGAGAGATGGAGAGGGG + Intronic