ID: 1057833003

View in Genome Browser
Species Human (GRCh38)
Location 9:98420799-98420821
Sequence CTGTGTAAAGGCCTGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057832997_1057833003 -5 Left 1057832997 9:98420781-98420803 CCAGGAAGAAGGAATCACCTGTG 0: 1
1: 1
2: 3
3: 37
4: 297
Right 1057833003 9:98420799-98420821 CTGTGTAAAGGCCTGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057833003 Original CRISPR CTGTGTAAAGGCCTGGAGGT GGG Intronic
No off target data available for this crispr