ID: 1057835689

View in Genome Browser
Species Human (GRCh38)
Location 9:98443216-98443238
Sequence GCCTCCTCTTTGTTTCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057835682_1057835689 5 Left 1057835682 9:98443188-98443210 CCACCATGTCCCTGGCTCCTTCC 0: 1
1: 0
2: 5
3: 99
4: 783
Right 1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG No data
1057835686_1057835689 -5 Left 1057835686 9:98443198-98443220 CCTGGCTCCTTCCAAGGAGCCTC 0: 1
1: 0
2: 4
3: 21
4: 286
Right 1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG No data
1057835685_1057835689 -4 Left 1057835685 9:98443197-98443219 CCCTGGCTCCTTCCAAGGAGCCT 0: 1
1: 0
2: 1
3: 30
4: 286
Right 1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG No data
1057835683_1057835689 2 Left 1057835683 9:98443191-98443213 CCATGTCCCTGGCTCCTTCCAAG 0: 1
1: 1
2: 2
3: 57
4: 486
Right 1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057835689 Original CRISPR GCCTCCTCTTTGTTTCTCCC AGG Intronic
No off target data available for this crispr