ID: 1057836523

View in Genome Browser
Species Human (GRCh38)
Location 9:98449772-98449794
Sequence CAGAAGAGGGGGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057836512_1057836523 13 Left 1057836512 9:98449736-98449758 CCAATTCTAGCCTGAGTTTCCTG 0: 1
1: 0
2: 2
3: 31
4: 252
Right 1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG No data
1057836515_1057836523 -6 Left 1057836515 9:98449755-98449777 CCTGGTTGCATAATTGACAGAAG 0: 1
1: 1
2: 1
3: 4
4: 107
Right 1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG No data
1057836514_1057836523 3 Left 1057836514 9:98449746-98449768 CCTGAGTTTCCTGGTTGCATAAT 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057836523 Original CRISPR CAGAAGAGGGGGATGGAGGA GGG Intronic
No off target data available for this crispr