ID: 1057836736

View in Genome Browser
Species Human (GRCh38)
Location 9:98451525-98451547
Sequence TCCCCACTGCCCCCCAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057836731_1057836736 -2 Left 1057836731 9:98451504-98451526 CCTCAGTGCCACCCAAGTGCCTC 0: 1
1: 0
2: 0
3: 35
4: 269
Right 1057836736 9:98451525-98451547 TCCCCACTGCCCCCCAGCAGTGG No data
1057836732_1057836736 -10 Left 1057836732 9:98451512-98451534 CCACCCAAGTGCCTCCCCACTGC 0: 1
1: 0
2: 2
3: 35
4: 358
Right 1057836736 9:98451525-98451547 TCCCCACTGCCCCCCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057836736 Original CRISPR TCCCCACTGCCCCCCAGCAG TGG Intronic
No off target data available for this crispr