ID: 1057836736 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:98451525-98451547 |
| Sequence | TCCCCACTGCCCCCCAGCAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1057836731_1057836736 | -2 | Left | 1057836731 | 9:98451504-98451526 | CCTCAGTGCCACCCAAGTGCCTC | 0: 1 1: 0 2: 0 3: 35 4: 269 |
||
| Right | 1057836736 | 9:98451525-98451547 | TCCCCACTGCCCCCCAGCAGTGG | No data | ||||
| 1057836732_1057836736 | -10 | Left | 1057836732 | 9:98451512-98451534 | CCACCCAAGTGCCTCCCCACTGC | 0: 1 1: 0 2: 2 3: 35 4: 358 |
||
| Right | 1057836736 | 9:98451525-98451547 | TCCCCACTGCCCCCCAGCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1057836736 | Original CRISPR | TCCCCACTGCCCCCCAGCAG TGG | Intronic | ||
| No off target data available for this crispr | |||||