ID: 1057837395

View in Genome Browser
Species Human (GRCh38)
Location 9:98456048-98456070
Sequence CTGAGCTGGACTAGAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057837395 Original CRISPR CTGAGCTGGACTAGAAATGC TGG (reversed) Intronic
900810323 1:4796920-4796942 GTGAGCGGGAGAAGAAATGCTGG - Intergenic
900976114 1:6017472-6017494 CTGGGCTGGTCTAGAATTCCAGG + Intronic
903003206 1:20281270-20281292 CTGAGCTGGAGATGAAATTCAGG - Intergenic
903045422 1:20560979-20561001 CTGGGCTGTACTAGAAAGTCAGG + Intergenic
903858007 1:26348345-26348367 CTAGGCTGGTCTAGAACTGCTGG - Intronic
904152617 1:28454908-28454930 CTGAGCTGGTCTCAAACTGCTGG - Intronic
904352030 1:29914733-29914755 CTGAGCTGGAATTCAAATGCAGG + Intergenic
906464351 1:46062859-46062881 CTAAGCTGGACTTGAAATCCTGG + Intronic
906777524 1:48543298-48543320 CTCAGCTGGGCTATAAAGGCTGG + Intronic
907132889 1:52112434-52112456 CTGGGCTGGACTTGAACTCCTGG + Intergenic
908078996 1:60554524-60554546 CTGAGCTGGTCTGGAACTCCTGG - Intergenic
908569078 1:65389799-65389821 CTGAGCTGGTCTTGAACTCCTGG - Intronic
911579804 1:99621542-99621564 GTGAGCTGGAAAGGAAATGCTGG + Intergenic
913386767 1:118266443-118266465 GTGAGCTGAACTTGAACTGCTGG + Intergenic
913718696 1:121567699-121567721 CAGAGCAGGACTACAAATGTGGG - Intergenic
915048863 1:153046234-153046256 CTGAGGTTGAATAAAAATGCTGG + Intergenic
915606150 1:156952489-156952511 CAGGGGTGGGCTAGAAATGCTGG + Intronic
916813815 1:168330968-168330990 CAGAGCTGCACTTGAAATCCAGG + Intergenic
917080219 1:171250235-171250257 CTGAGGTAGAATAGAAATGAAGG - Intronic
917210944 1:172631653-172631675 CTGAGCTAGTATAGAAATGTGGG - Intergenic
919092422 1:192991579-192991601 CTAAGCTGGTCTTGAAATCCTGG - Intergenic
920049131 1:203152741-203152763 CTGACCTGGACAGTAAATGCAGG - Intronic
920110916 1:203586455-203586477 CTGAGCAGGACCAGAAGGGCGGG - Intergenic
920656089 1:207876277-207876299 CAGAGCTGGACCCCAAATGCAGG + Intergenic
921673786 1:217954927-217954949 CAGAGCTGGATTAGAAAGCCAGG - Intergenic
921741333 1:218688254-218688276 CACAGCTGGACCAGAACTGCTGG + Intergenic
924810520 1:247397265-247397287 CTGGGCTGGCCTTGAACTGCTGG + Intergenic
924929690 1:248718601-248718623 CTAAGCTGGTCTTGAAATCCTGG - Intergenic
1066261809 10:33736646-33736668 CTGAGCTGGTCTTGAACTCCTGG + Intergenic
1069596781 10:69677100-69677122 ATGAGCTGGGCTTGAAATCCAGG + Intergenic
1069815908 10:71194170-71194192 GAGAGCTGGACTGGAATTGCTGG + Intergenic
1072130109 10:92485731-92485753 CTGGGCTGGTCTAGAACTCCTGG - Intronic
1072301231 10:94064339-94064361 CTGGGCTGGTCTTGAAATCCTGG - Intronic
1072703536 10:97662785-97662807 CTGAGAATGACTACAAATGCTGG - Intronic
1072844514 10:98815056-98815078 CTGGGCTGGTCTAGAATTCCTGG - Intronic
1073429845 10:103478987-103479009 CCGAGCTTGACTGGAAGTGCTGG + Exonic
1074103586 10:110373081-110373103 TTGTGCTGGAGCAGAAATGCTGG + Intergenic
1075410702 10:122225920-122225942 CTCAGCTGGACTAGAAACAGGGG - Intronic
1075881084 10:125851459-125851481 GTTTGGTGGACTAGAAATGCAGG - Intronic
1075957144 10:126533884-126533906 CTGGGCTGAATTACAAATGCTGG + Intronic
1076012748 10:127003624-127003646 CTGAGCAGGGCTAGGAAGGCTGG - Intronic
1079076603 11:17388751-17388773 CTGAGCTGGGCTGGGAAGGCAGG - Intronic
1080332476 11:31155084-31155106 ATGAACAGGATTAGAAATGCGGG - Intronic
1080521876 11:33074718-33074740 CTAGGCTGGACTTGAAATCCTGG - Intronic
1083265128 11:61543078-61543100 CAGAGCTGGCCTAGTAATCCTGG + Intronic
1085187328 11:74587337-74587359 CTAAGCTGGACTCGAACTCCTGG + Intronic
1085494005 11:76950675-76950697 CTGAGCTGGTCTTGAAGTCCTGG + Intronic
1085716352 11:78877071-78877093 CTGAGCTGGGTTTGGAATGCAGG + Intronic
1087229761 11:95647157-95647179 CTGAGCTGGAATAGAAACTAGGG - Intergenic
1087520311 11:99225201-99225223 CTGAGTTGGAATAGAAAGGTAGG + Intronic
1088040362 11:105374420-105374442 GTGATCTGGACTGGAAATTCAGG - Intergenic
1088231543 11:107678111-107678133 CTGAGCTGAGCCAGAAAAGCTGG - Intergenic
1088249738 11:107852206-107852228 CTGAGCTGGTCTTGAACTCCTGG - Intronic
1091193683 11:133714789-133714811 CTGAGCTAGACAAGACAGGCAGG - Intergenic
1091625405 12:2117571-2117593 CAGAGCTGGACTTCAAATCCAGG + Intronic
1092281250 12:7099438-7099460 ATGAGATGGACTAGAAAAGGAGG - Intronic
1092895964 12:13010671-13010693 CTGTCCTGGATGAGAAATGCTGG - Intergenic
1094238752 12:28199121-28199143 CTGAGCTGGTCTTGAACTCCTGG + Intronic
1096107966 12:49009330-49009352 CTGAGCTGGTCTTGAACTCCTGG + Intronic
1097784635 12:63745666-63745688 CTGGGCTGGTCTTGAAATCCTGG - Intergenic
1098774200 12:74590434-74590456 TTGAGATGGTCAAGAAATGCGGG + Intergenic
1100265958 12:92976574-92976596 CTGAGCTGAACTTAAAATTCTGG - Intergenic
1100721997 12:97369036-97369058 CAGAGCTGGTCTAGAGTTGCTGG - Intergenic
1101431239 12:104629132-104629154 CAGGGCTGGAATACAAATGCAGG - Intronic
1102973207 12:117187732-117187754 ACCAGCTGGACTAGAAATGGAGG + Intronic
1103024855 12:117565130-117565152 CAGAGCTGGAATCCAAATGCTGG + Intronic
1103144253 12:118580724-118580746 CTGGGCTGGTCTAGAACTCCTGG - Intergenic
1103204557 12:119118383-119118405 TTGAACTGGACTTGAGATGCAGG - Intronic
1103246276 12:119460582-119460604 CTGAGCTAGGCTAGAATTGCTGG + Intronic
1103726352 12:122999206-122999228 CTGAGCTGGAGGAGGAAGGCTGG + Intronic
1104635987 12:130438122-130438144 CTGCTCTGGATTAAAAATGCAGG - Intronic
1104639212 12:130456668-130456690 GAGAGCTGGAAGAGAAATGCCGG - Exonic
1104964090 12:132501255-132501277 CACAGCTGGACTAGAATTCCGGG + Intronic
1106071870 13:26420078-26420100 CTGGGCTGGTCTAGAACTCCCGG + Intergenic
1108583791 13:51850003-51850025 CTGAGCTGGTCTCGAACTCCTGG - Intergenic
1109235675 13:59815663-59815685 CTAAGCTGGTCTTGAAATCCTGG + Intronic
1109625686 13:64970601-64970623 CTGAGCTGGACTAACCATGTTGG + Intergenic
1109666513 13:65546481-65546503 CTGAGCTGGTCTTGAATTCCTGG - Intergenic
1112052045 13:95652686-95652708 CTCCTCTGGACTTGAAATGCTGG - Intergenic
1112121618 13:96418688-96418710 CTGAGCTGGAGAGGAAATGTTGG + Intronic
1112341563 13:98556830-98556852 CTAAACTGGACAAGAGATGCAGG + Intronic
1112607215 13:100918663-100918685 CTCAGCTGAAGTAGAAATGCTGG - Intergenic
1114794817 14:25701617-25701639 CTGAGCTGACCTAGAAAGACTGG - Intergenic
1115233232 14:31184237-31184259 CTAGGCTGGTCTAGAAATCCTGG - Intronic
1117714170 14:58563672-58563694 CTGAGCTGGTCTCGAACTCCTGG - Intergenic
1118058387 14:62107222-62107244 CCAGGCTGGACTAGAAATCCTGG - Exonic
1124410017 15:29429428-29429450 CAGGGCTGGTCTAGAAATTCTGG + Intronic
1125612432 15:40980523-40980545 CTGAGCTGGAGGAGAAGTGGTGG + Intronic
1126859310 15:52868941-52868963 CTCAGGTGGACTGGAAAAGCTGG + Intergenic
1128031396 15:64483742-64483764 CTGAGCTGGCCTTGAACTCCTGG + Intronic
1132478076 16:152571-152593 CAGAACTGGACTACAAATGCAGG + Intergenic
1133667340 16:7981791-7981813 CTCAGCTGGACTAGACATCCAGG + Intergenic
1133689494 16:8199506-8199528 CTGAGAGGGAGTAGAAATTCCGG - Intergenic
1133721366 16:8497422-8497444 CAGGGCTGGTCTAGAAATCCTGG + Intergenic
1135243377 16:20831036-20831058 CTAAGCTGGACTGGAACTCCTGG + Intronic
1135614961 16:23903182-23903204 CTGAGCAGGACAACAAAAGCGGG - Intronic
1136565700 16:31068817-31068839 CTGGGCTGGTCTAGAACTCCTGG + Intronic
1138361619 16:56434342-56434364 CTGAGGGAGACTAGAAATGATGG + Exonic
1139627805 16:68205346-68205368 CTGAGGTGGGAGAGAAATGCTGG - Intronic
1140309229 16:73833151-73833173 CTGGGCTGGTCTAGAACTCCTGG - Intergenic
1141275139 16:82580624-82580646 CAGAGCTTAGCTAGAAATGCAGG - Intergenic
1143112080 17:4558533-4558555 CTCAGCTGGCCCAGAACTGCTGG - Exonic
1143146655 17:4780967-4780989 CTGGGCTGGTCTAGAACTCCTGG - Intronic
1144471230 17:15543213-15543235 CTGAGCTGGAGTTGCAGTGCTGG - Intronic
1144925236 17:18801480-18801502 CTGAGCTGGAGTTGCAGTGCTGG + Intronic
1146487250 17:33253196-33253218 CAGAGCTGGAGTTCAAATGCAGG + Intronic
1146603883 17:34241350-34241372 CTGAACTGGACCACAAATTCAGG - Intergenic
1146672523 17:34751440-34751462 CTGAGCTAGATTAGAACTGAGGG - Intergenic
1147976810 17:44252718-44252740 CTGAGCTGGAAGAGAACTGGGGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149412150 17:56419582-56419604 CTCAGGTGGTCTAGAAATCCTGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151460074 17:74249184-74249206 ATGAGCTGGACTTGAAGTTCAGG - Intronic
1152203106 17:78958591-78958613 CTGAGGTGGGCTGGAAAGGCCGG + Intergenic
1153014568 18:571989-572011 CCGAGCTGGACTAAAAAGGGGGG - Intergenic
1153687771 18:7564005-7564027 CCAAGCTGGTCTAGAAATCCTGG + Intergenic
1153937003 18:9936497-9936519 CTGAGCTGGTCTCGAACTCCTGG - Intronic
1154981301 18:21504624-21504646 CTAAGCTGGTCTTGAACTGCTGG - Intronic
1155289135 18:24323341-24323363 CTGGGCTGGTCTCGAACTGCTGG - Intronic
1155436002 18:25813659-25813681 CTGAGATGGACTAGGAAGGATGG - Intergenic
1157962577 18:52172672-52172694 CTGGGCTGGTCTTGAAATCCTGG + Intergenic
1158422114 18:57304349-57304371 CTGAGCTGGACCTGAAACCCAGG + Intergenic
1160568773 18:79802568-79802590 CTGAGCTGGAGAAGGAAGGCAGG - Intergenic
1161121615 19:2530104-2530126 CTGAGGTCCACTAGAAAAGCTGG + Intronic
1161789393 19:6349919-6349941 CTGAGCTGGTCTTGAACTCCTGG - Intergenic
1162417509 19:10546956-10546978 CTGAGCTGGAGCAGGAACGCCGG + Exonic
1162576855 19:11504514-11504536 AAGAGCAGGACTGGAAATGCTGG - Intronic
1162767359 19:12928152-12928174 CTGAGCTGGATTTGAACTCCTGG + Intronic
1166890104 19:45986304-45986326 CAGAGCTGGAATTGAAATCCAGG + Intergenic
1167573262 19:50304151-50304173 CTGAGATGGGCTATAAATGTAGG + Intronic
926686359 2:15701339-15701361 CAGAGCTGGGCTTAAAATGCAGG - Exonic
927752380 2:25680970-25680992 CTAAGCTGATCTTGAAATGCTGG + Intergenic
928834694 2:35529756-35529778 CTGGGCTGGTCTAGCGATGCTGG + Intergenic
930112781 2:47693279-47693301 CTAAGCTGGACTAAAACTCCTGG + Intergenic
932848113 2:75155509-75155531 GTGAGCTGGACCAGAAGAGCTGG - Intronic
937010839 2:118561259-118561281 TTGAGCTGGACTATAAAATCTGG + Intergenic
937534065 2:122864476-122864498 ATGAACTGGACTAGAAGAGCAGG + Intergenic
937709034 2:124957662-124957684 CTGAACTGGTCTAGAACTCCTGG - Intergenic
937710512 2:124975507-124975529 CTGAGCTGGTCTGGGAATGCAGG - Intergenic
938005415 2:127786471-127786493 CTGAGCTGGTCTTGAACTCCTGG - Intronic
940659625 2:156530899-156530921 CTGGGCTGGACTTGAACTCCTGG + Intronic
943614890 2:190081699-190081721 GTGAGCTGGAAGGGAAATGCAGG - Intronic
943701390 2:190991647-190991669 CTGAGCTGGTCTTGAACTCCTGG - Intronic
946795104 2:223342143-223342165 CTGATTTGGACTGAAAATGCTGG - Intergenic
946828315 2:223701717-223701739 CTGAACTAGACTTGAAATACTGG - Intergenic
947096944 2:226577236-226577258 TTGAGCTGGATTAGAAAGGATGG + Intergenic
947383537 2:229568258-229568280 CTAAGCTGGACTTGAACTCCTGG + Intronic
948308900 2:236970461-236970483 CTTAGCTGGACTAAAAAGGGAGG - Intergenic
1169497083 20:6125322-6125344 CTGAGCTGGTCTTGAACTCCTGG + Intergenic
1169682251 20:8228467-8228489 CTGACCTGGAGGACAAATGCGGG - Intronic
1169743717 20:8921591-8921613 ATCAGCTGGCCTAGAAAAGCAGG + Intronic
1171990566 20:31693256-31693278 CTGGGCTGGTCTAGAACTCCTGG - Intronic
1174994759 20:55553604-55553626 ATGAGCTGGATTAGCAATGCCGG + Intergenic
1179541522 21:42086045-42086067 CTGAGCTGGAGAAGACATCCTGG - Intronic
1180655452 22:17416709-17416731 CCGAGCTGGTCTGGAACTGCTGG + Intronic
1182411358 22:30189666-30189688 CTGAGCTGGGCAAGGAATGAAGG - Intergenic
1183240711 22:36656338-36656360 CTAAGCTGGCCTACAAACGCAGG + Intronic
1183578512 22:38707697-38707719 ATGAGCTGGTCAAGAAATGAAGG - Intronic
949170982 3:996443-996465 CTAAGCTGGTCTAGAACTCCTGG + Intergenic
949454092 3:4219964-4219986 ATGAGCTGGAGTAGAAAGACTGG + Intronic
950337145 3:12204697-12204719 CTGAGCTGGTCTTGAACTACTGG + Intergenic
950728512 3:14935597-14935619 CTGGGCTGGTCTAGAACTCCTGG - Intergenic
950838758 3:15946714-15946736 CAAAGCTGGATTAGAAATGAGGG - Intergenic
950883903 3:16346507-16346529 CTGAGGGGGACTAGCAAGGCAGG - Intronic
953295630 3:41712678-41712700 CTGAGCTGGTCTTGAACTCCTGG - Intronic
953323213 3:41990707-41990729 CTGGGCTGGTCTTGAAATCCTGG - Intergenic
953540215 3:43811367-43811389 GTGGGCTGGACTAGGCATGCTGG + Intergenic
954026163 3:47785015-47785037 CCAAGCTGGACTTGAAATCCTGG - Intergenic
954186422 3:48920188-48920210 CTAAGCTGGTCTTGAACTGCTGG + Intronic
955974092 3:64464051-64464073 CTGAGCTGGATCAAAATTGCAGG + Intergenic
956347136 3:68292750-68292772 CCAAGCTGGTCTAGAAATTCTGG + Intronic
957392950 3:79602449-79602471 CTCAGCAGGACCAGAAATGGAGG + Intronic
959918318 3:111843599-111843621 CTGGGCTGGTCTTGAAATCCTGG + Intronic
960444631 3:117732904-117732926 CTGAGCTGGTCTTGAACTCCTGG + Intergenic
961322037 3:126083261-126083283 CTGAGATCTGCTAGAAATGCGGG - Intronic
964848918 3:161072943-161072965 CAGAGCTGGATGACAAATGCTGG - Exonic
967105338 3:186251019-186251041 CTGAGCTACACTAGATGTGCTGG + Intronic
967856926 3:194125073-194125095 CTGGGCTGGCCTTGAAATCCTGG + Intergenic
968612967 4:1565359-1565381 CTCAGCTGGGCCAGAAATGGGGG + Intergenic
969298922 4:6285787-6285809 GTGAGTTGGACCAGAAAGGCTGG + Intronic
969335267 4:6504471-6504493 CTGAGATGGACCCCAAATGCTGG + Intronic
970446966 4:16131607-16131629 CTGAGATGCACTAGAAATTTTGG + Intergenic
970754059 4:19402603-19402625 CTGAGCTGGATTTCAAATCCAGG - Intergenic
971102667 4:23485071-23485093 CTCAGCCAGACTAGAAATCCAGG + Intergenic
972337020 4:38116224-38116246 CAGAGCTGGACTGGAAACCCAGG + Intronic
972761533 4:42110074-42110096 CTGAGCTGGTCTTGAACTCCTGG - Intergenic
974357068 4:60825951-60825973 CAGAGCTGGACTAGAAACTCAGG - Intergenic
976177264 4:82367073-82367095 CCTAGCTGGTCTAGAAATCCTGG + Intronic
976238346 4:82925403-82925425 CTGGGCTGGTCTAGAACTCCTGG + Exonic
978335529 4:107664417-107664439 GTGAGCTGAACTAGGGATGCTGG - Intronic
978989181 4:115056687-115056709 CTGAGCATGACCAAAAATGCAGG - Intronic
981301681 4:143193874-143193896 CTGAGCTGGTCTTGAAATCCTGG - Intronic
985429020 4:189860122-189860144 CTGGGCTGGTCTTGAACTGCTGG - Intergenic
986569692 5:9152256-9152278 CTGAGCTGGAGTTGAAAGACTGG + Intronic
988571123 5:32367621-32367643 CTGAGCTGGTCTTGAACTCCTGG + Intronic
989959901 5:50400336-50400358 CAGAGCAGGACTACAAATGTGGG + Intronic
990779225 5:59339688-59339710 CTGAGCTGTAATAGGAATTCAGG - Intronic
992957874 5:81929089-81929111 CAGAGCTGGAATAGAAATCTAGG + Intergenic
996732239 5:126727348-126727370 CTAAGCTGGTCTAGAACTCCTGG - Intergenic
996747406 5:126857269-126857291 CTGAGCTGGCCCAGACATGGAGG - Intergenic
997298447 5:132784524-132784546 CTGGGCTGGTCTAGAACTCCTGG - Intronic
998125026 5:139612847-139612869 CTGGGCTGGACTTGAACTCCTGG + Intronic
999551680 5:152694461-152694483 CTGAGCTGGGCTGTAAGTGCAGG + Intergenic
1001764839 5:174237388-174237410 CTGAGCTGTACTAGAATGGGGGG + Intronic
1002029557 5:176417578-176417600 CTGGGCTGGTCTTGAACTGCTGG + Intergenic
1004331236 6:14723445-14723467 CTGGGCTGGTCTTGAAATCCTGG - Intergenic
1004636116 6:17469347-17469369 CTTAGCAGCACGAGAAATGCTGG - Intronic
1006583441 6:35089772-35089794 CTGGACTAGAGTAGAAATGCAGG + Exonic
1006903372 6:37517004-37517026 CTGAGCTGAACTAGGACTCCCGG - Intergenic
1007166921 6:39835151-39835173 CTGAACAGGCCAAGAAATGCTGG + Intronic
1007181750 6:39934025-39934047 CTGAGCTTGGCCAGAAATTCGGG - Intronic
1007424123 6:41735719-41735741 CTGAGCGGGACTACAAATCCCGG - Intronic
1010163339 6:72885413-72885435 CTAAGCTGGACTTGGAATCCTGG - Intronic
1011847732 6:91587431-91587453 CTGAGGAGGACTAGAATGGCTGG - Intergenic
1012904158 6:105044955-105044977 CTGAGCTGGTCTCGAACTCCTGG - Intronic
1013528145 6:110994373-110994395 CTAGGCTGGTCTAGAAATCCTGG - Intronic
1015749387 6:136544883-136544905 CTGGGCTGGACTTGAACTCCTGG - Intronic
1017474275 6:154772478-154772500 CTGGGCTGGTCTTGAACTGCTGG - Intronic
1017633739 6:156423615-156423637 CTAAGCTGGACAGAAAATGCAGG + Intergenic
1018867747 6:167758963-167758985 CTGAGCTGGATGAGGAAGGCAGG + Intergenic
1020399675 7:7761153-7761175 CTGAGCTGAACTTGAATTCCTGG - Intronic
1022354604 7:29600986-29601008 TTGAGTTGGACTTGAAAGGCTGG + Intergenic
1024254171 7:47527533-47527555 CTGAACTGGACAAGCTATGCAGG + Intronic
1024270081 7:47635561-47635583 GTGAGCTGACCTGGAAATGCTGG + Intergenic
1025836061 7:65094662-65094684 CTGGGATGGACTAGAACTCCTGG + Intergenic
1025905831 7:65784113-65784135 CTGGGATGGACTAGAACTCCTGG + Intergenic
1026675446 7:72424484-72424506 ATGAGATGGTCTTGAAATGCTGG - Intronic
1026951830 7:74352797-74352819 CTGAGCTGGTCTGGAACTCCGGG - Intronic
1028109511 7:86921787-86921809 ATGTACTGGACAAGAAATGCAGG + Intronic
1028397235 7:90384250-90384272 CTGATATGAACTAGAAAGGCTGG - Intronic
1028783817 7:94769113-94769135 CTGGGCTGGTCTTGAAATCCTGG + Intergenic
1029236512 7:99124237-99124259 CAGAGCTGTACTGGAAATCCAGG + Intronic
1029613562 7:101641827-101641849 CTGAGCTGGTCTTGAATTCCTGG - Intergenic
1030831238 7:114224726-114224748 CTGAGTTGGCCTGGAACTGCAGG + Intronic
1032270026 7:130396319-130396341 CTGAGCAGGAAAAGAAATCCAGG + Exonic
1033170579 7:139080107-139080129 CTGATCTGGACTAGGTGTGCAGG + Exonic
1034341354 7:150358382-150358404 CTGGGCTGGACTTGAACTCCTGG - Intergenic
1034517384 7:151591400-151591422 GTGGGCTGGACTAGACAGGCAGG + Intronic
1035360866 7:158313517-158313539 CTGAGCAAGACTGGAGATGCAGG + Intronic
1036824521 8:11965769-11965791 CTGACCTTGTCTAGAATTGCTGG + Intergenic
1038188958 8:25301330-25301352 CAGACCTAGAGTAGAAATGCAGG + Intronic
1039689384 8:39847614-39847636 CCAGGCTGCACTAGAAATGCAGG + Intergenic
1041783517 8:61605394-61605416 CTGACCTGCACGAAAAATGCAGG + Intronic
1041862259 8:62528089-62528111 CTGAACTGGACTGGAAGTGTGGG - Intronic
1042643998 8:70965907-70965929 CAGAGCTGAACTAGAAAACCAGG - Intergenic
1044510747 8:93075698-93075720 CTGAGCTGGACCTGAAGGGCAGG + Intergenic
1046633787 8:116649477-116649499 CTGAGCTGCAATAGAAATTTCGG - Intronic
1046798994 8:118404191-118404213 CTAAGCTGGTCTAGAACTCCTGG + Intronic
1047416600 8:124669400-124669422 GTGAGCTGTACTGTAAATGCTGG - Intronic
1048328020 8:133453458-133453480 CAGAGCTGGCCTGGAAAAGCGGG + Intergenic
1052847561 9:33350779-33350801 CTAAGCTGGACTTGAACTTCTGG - Intronic
1053364496 9:37512908-37512930 CAGAGCTGGACGTGGAATGCAGG - Intronic
1054818211 9:69496053-69496075 AAGAGCTGGACTATATATGCTGG + Intronic
1057695689 9:97321670-97321692 CTGCTCTGGACTGGAAGTGCCGG - Intronic
1057837395 9:98456048-98456070 CTGAGCTGGACTAGAAATGCTGG - Intronic
1059988575 9:119843068-119843090 CAGAGCTGGGATAGAAATCCAGG - Intergenic
1060494699 9:124109833-124109855 CAGAGCTGGGATACAAATGCAGG + Intergenic
1061496416 9:130977421-130977443 ATGAGCTGGGCTAAAATTGCAGG + Intergenic
1061532071 9:131222260-131222282 CTGAACTTGACTATAAAAGCAGG + Intronic
1186314317 X:8352271-8352293 CTGAGCTGGTCTCGAACTCCTGG - Intergenic
1186414148 X:9368974-9368996 CTGAGCTGGTCTCGAACTCCTGG - Intergenic
1186443692 X:9607672-9607694 CTCAGCTGGACTTGGAAAGCAGG - Intronic
1187481490 X:19659882-19659904 ATCAACTGGACTATAAATGCTGG + Intronic
1188727197 X:33600579-33600601 CTGTGTTGGAGTGGAAATGCTGG + Intergenic
1189090235 X:38074458-38074480 CTGAGCTGGCCTTGAACTCCTGG + Intronic
1189447088 X:41090114-41090136 CTAAGCTGGTCTTGAACTGCTGG + Intronic
1196211325 X:112998928-112998950 CAGAGATGGGCTAGAAAAGCTGG + Intergenic
1196866959 X:120078705-120078727 CTGGGCTGGTCTGGAACTGCTGG + Intergenic
1196876140 X:120157577-120157599 CTGGGCTGGTCTGGAACTGCTGG - Intergenic
1197377030 X:125693096-125693118 ATGAGCTTTACTAGCAATGCAGG + Intergenic
1197732542 X:129823619-129823641 CTGAGTTGAACTAGAAAGTCAGG - Intronic
1199502729 X:148526646-148526668 CTGAGATGGCCTAGAAATAATGG - Intronic
1200332578 X:155313136-155313158 CTGGGCTGGTCTAGAACTCCTGG - Intronic