ID: 1057839561

View in Genome Browser
Species Human (GRCh38)
Location 9:98474759-98474781
Sequence AGTGAGGGTCTGTCCACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057839557_1057839561 0 Left 1057839557 9:98474736-98474758 CCACTTAGGCTCCAGGAGGCTAA No data
Right 1057839561 9:98474759-98474781 AGTGAGGGTCTGTCCACAGAAGG No data
1057839555_1057839561 4 Left 1057839555 9:98474732-98474754 CCTTCCACTTAGGCTCCAGGAGG No data
Right 1057839561 9:98474759-98474781 AGTGAGGGTCTGTCCACAGAAGG No data
1057839552_1057839561 23 Left 1057839552 9:98474713-98474735 CCTGGGAAGGTTCTTGCTGCCTT No data
Right 1057839561 9:98474759-98474781 AGTGAGGGTCTGTCCACAGAAGG No data
1057839551_1057839561 24 Left 1057839551 9:98474712-98474734 CCCTGGGAAGGTTCTTGCTGCCT No data
Right 1057839561 9:98474759-98474781 AGTGAGGGTCTGTCCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057839561 Original CRISPR AGTGAGGGTCTGTCCACAGA AGG Intronic