ID: 1057842599

View in Genome Browser
Species Human (GRCh38)
Location 9:98498238-98498260
Sequence GGTGGGGAGTGATTGTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057842593_1057842599 -1 Left 1057842593 9:98498216-98498238 CCAGCAGCTGAGGGAAGGAGGGG 0: 1
1: 1
2: 7
3: 84
4: 648
Right 1057842599 9:98498238-98498260 GGTGGGGAGTGATTGTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057842599 Original CRISPR GGTGGGGAGTGATTGTTTAA TGG Intronic
No off target data available for this crispr