ID: 1057845312

View in Genome Browser
Species Human (GRCh38)
Location 9:98518153-98518175
Sequence CAACTGCTCTGGAGGACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057845312_1057845322 27 Left 1057845312 9:98518153-98518175 CCCCTTGTCCTCCAGAGCAGTTG 0: 1
1: 0
2: 3
3: 24
4: 222
Right 1057845322 9:98518203-98518225 CCCTGGAGCTGCAGTAGCCCTGG No data
1057845312_1057845317 10 Left 1057845312 9:98518153-98518175 CCCCTTGTCCTCCAGAGCAGTTG 0: 1
1: 0
2: 3
3: 24
4: 222
Right 1057845317 9:98518186-98518208 CTCCAGCCATTGCTAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057845312 Original CRISPR CAACTGCTCTGGAGGACAAG GGG (reversed) Intronic
900898202 1:5498495-5498517 CATCTGCCCTGGAGCACACGTGG - Intergenic
902225683 1:14995093-14995115 CAGCTGCCCTGGAGGAAGAGGGG + Intronic
902239008 1:15075903-15075925 GAAGTGCTCTGGAGGGCAGGTGG - Intronic
905894197 1:41534526-41534548 CAAGTGCCCTGGAGCAGAAGTGG - Intronic
911979467 1:104548625-104548647 CAGTTCCTCTGGAGGTCAAGCGG + Intergenic
915748644 1:158183916-158183938 CACCTGCTCTGGAGGAACATAGG - Exonic
917594484 1:176515318-176515340 GAACTGCACTGGAGGATGAGTGG + Intronic
922581150 1:226698963-226698985 CAACTGCTATGAAGGACACAGGG + Intronic
924471722 1:244348821-244348843 CAGCTACTCAGGAGGCCAAGTGG - Intergenic
1064987284 10:21223621-21223643 CAACTACTATGGAGAACAATTGG - Intergenic
1065612118 10:27482332-27482354 CAGCTACTCAGGAGGTCAAGAGG - Intergenic
1068688122 10:59889836-59889858 CAACCCCTCTGGAGGATAAAGGG - Intronic
1069172733 10:65254154-65254176 CAACTGCTGCGGAGGCCAAAGGG - Intergenic
1069731050 10:70613668-70613690 CAGCTGCTCGGGAGGCTAAGCGG + Intergenic
1069837525 10:71318833-71318855 CCGCTGCTCTGGAGGTGAAGCGG - Intergenic
1069944628 10:71977327-71977349 CTACTGCCCTGCAAGACAAGAGG - Intronic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1072641541 10:97214821-97214843 CATCTGGTGTGGAGGAAAAGGGG - Intronic
1074911693 10:117915815-117915837 CAAATGCTGTTGAGGACATGGGG + Intergenic
1076530389 10:131140863-131140885 CGCCTGCACTGGAGGGCAAGAGG + Intronic
1076590346 10:131578221-131578243 CGACTGGTCTGCAGAACAAGAGG - Intergenic
1076842069 10:133050590-133050612 CAGCTGCTCCGCAGGACAGGCGG + Intergenic
1077104107 11:834554-834576 CGACTCCTCTGCAGGACAGGTGG - Exonic
1078001273 11:7498253-7498275 TAACTGCTCTGCAGGAGCAGAGG + Intronic
1078781283 11:14441525-14441547 CAGCTACCCTGGAGGAGAAGAGG + Intergenic
1081747857 11:45485506-45485528 CCCCTGCTCTGGAGGCCAAGGGG + Intergenic
1083121015 11:60511879-60511901 CATCTGCTCTGTGGGAAAAGGGG - Intergenic
1084445494 11:69201084-69201106 CATCAGCTCAGGAGGACAAGGGG + Intergenic
1084976249 11:72800655-72800677 CAGCTGCTCAGGAGGCTAAGGGG - Intergenic
1086367218 11:86119583-86119605 CAGCTACTCGGGAGGATAAGGGG + Intergenic
1088256227 11:107905850-107905872 CAAAAGCTTTAGAGGACAAGAGG + Intronic
1091351271 11:134897783-134897805 CAACTGCACTGGAGAAGAACAGG + Intergenic
1093590918 12:20901414-20901436 CAACAGCTGTGGAGCACAAGGGG + Exonic
1093604772 12:21076516-21076538 CAACAGCTGTGGAGCACGAGGGG + Exonic
1095557430 12:43523761-43523783 CAACCCCTCTGGGGGTCAAGGGG - Intronic
1096158449 12:49356070-49356092 CAACTACTCTGGAGGCTGAGTGG + Intronic
1096751937 12:53765273-53765295 GAACTGCTCAGGAGACCAAGGGG - Intergenic
1098056589 12:66512858-66512880 CAACTTTTCTGGAAGACAATTGG + Intronic
1099959986 12:89387717-89387739 CAGCTACTCGGGAGGCCAAGAGG - Intergenic
1102058065 12:109911497-109911519 CAACTACTCGGGAGGCTAAGTGG + Intronic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1103104193 12:118208618-118208640 CAACTGCTTTGAAGGACAAATGG + Intronic
1106244175 13:27933228-27933250 CCACTGGACTGGAGGACAAAGGG - Intergenic
1107039909 13:35937467-35937489 CCCCTACTCTGCAGGACAAGGGG - Intronic
1107717584 13:43216080-43216102 CAGCTACTCAGGAGGCCAAGAGG + Intronic
1108700835 13:52942780-52942802 CACCAGCTCTGTAGGCCAAGTGG + Intergenic
1109676137 13:65677197-65677219 CAACTGCTCTGGTGTACTGGAGG + Intergenic
1109721679 13:66283449-66283471 CCACTGCTCTGGAGGGCACAAGG - Intergenic
1117152874 14:52907124-52907146 CAGCTGCTCAGGAGGTTAAGCGG - Intronic
1119703212 14:76768887-76768909 CTACTGTGCTGGTGGACAAGGGG + Intronic
1119758759 14:77137047-77137069 CATCTGCACAGGAGGACAGGTGG - Intronic
1121291197 14:92777053-92777075 CATCTGCTGTGGAGGACTGGGGG - Intergenic
1121698262 14:95930448-95930470 CAACTTTTCTGGAGGAAAATGGG - Intergenic
1122862461 14:104588686-104588708 CAACGGCACTGGAGGACCTGCGG + Exonic
1126375975 15:47996895-47996917 CAAGTGACCTGGAAGACAAGTGG - Intergenic
1128654571 15:69451182-69451204 AAACTGATCTGGTTGACAAGTGG - Intergenic
1129782500 15:78282347-78282369 TAACTGCTATGAAGAACAAGAGG + Intronic
1131615099 15:94007958-94007980 CAATTGGTTTGCAGGACAAGGGG - Intergenic
1134217891 16:12330533-12330555 CGACAGCTCTGGACGACAGGTGG + Intronic
1135644896 16:24153200-24153222 CAACTCAGCTGGAGGACCAGAGG - Intronic
1136059833 16:27718889-27718911 CAGCTGCGGTGGAGGACAAAGGG - Intronic
1137454032 16:48604437-48604459 CAGCTACTCAGGAGGCCAAGAGG + Intronic
1140837443 16:78808239-78808261 TGACTGCTCTTGAGGACTAGAGG - Intronic
1141607174 16:85160709-85160731 CAGCTGCTCTGGAAGGCAGGGGG + Intergenic
1141645695 16:85366250-85366272 CAGCTGCTCCGGAGGGCACGGGG + Intergenic
1141974153 16:87503594-87503616 CAGCTGCTCTGGAGGGGACGGGG - Intergenic
1142212627 16:88815763-88815785 CTCCTGCTCTGGTGGCCAAGGGG - Intronic
1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG + Intronic
1144692204 17:17274931-17274953 CAACTGATAGGCAGGACAAGAGG - Intronic
1146319604 17:31836562-31836584 CAACTGCTCAGGAGGCTGAGTGG - Intergenic
1146498338 17:33343033-33343055 CAACAGGTCTGAAGGATAAGAGG + Intronic
1146599890 17:34205144-34205166 CACCTGCTGAGGAGGATAAGAGG - Intergenic
1146736436 17:35242758-35242780 GAAGTTCTCTGGAGGACATGGGG + Intergenic
1151734689 17:75931817-75931839 CAACTGCTCCAGATCACAAGAGG + Intronic
1151805187 17:76400624-76400646 TTCCTGCTCTGGAGGTCAAGTGG - Intronic
1155674254 18:28410272-28410294 CAATTGCTCTGGAGAACAGAGGG - Intergenic
1159602067 18:70437597-70437619 CAACCACTCTGGAGAACAATTGG - Intergenic
1162459990 19:10809277-10809299 CAATTTATCTGGAGGACAAGAGG - Intronic
1163203940 19:15788609-15788631 CAGCTGCTTAGGAGGCCAAGTGG - Intergenic
1163479102 19:17544178-17544200 CAGCTACTCTGGAGGCCAAGAGG + Intronic
1165153496 19:33774101-33774123 CACATGCTCTGGAGGAGGAGAGG + Intergenic
1165733349 19:38160378-38160400 CAGCTGCTCTGGATGTCAACTGG - Intronic
1167762499 19:51458341-51458363 CCCCTGCTCTGGGGGACAAAGGG - Exonic
1168383950 19:55947134-55947156 CAACTACTCTGGATGACAGTGGG - Intergenic
925400236 2:3567417-3567439 GAATTGCTGTGGAGGTCAAGTGG + Intergenic
926945059 2:18178405-18178427 CAACTGCCGAGGAGGAAAAGGGG - Intronic
928135289 2:28683232-28683254 CAACGGCTCTTGAGGACACTTGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
934095551 2:88599754-88599776 CTACTGCTTTAGAGGAAAAGAGG - Intronic
934893110 2:98087626-98087648 CAGCCGCTCTGGTGGAAAAGCGG + Intronic
935499702 2:103823492-103823514 TAGCTGCTTTGGAGGATAAGAGG + Intergenic
936117420 2:109713148-109713170 ACCCTGCTCTGGAGGAAAAGCGG - Intergenic
936238459 2:110766914-110766936 CATCTGCTCTGCAAGACAAGAGG + Intronic
936286068 2:111182322-111182344 CAACTGCTCTGGAGCAGGCGTGG - Intergenic
936563532 2:113563240-113563262 CCACTGCCCTGGAGGACCAGGGG + Intergenic
937086082 2:119172775-119172797 TAGCTACTCTGGAGGCCAAGCGG + Intergenic
939059738 2:137406581-137406603 CAACTGCTCATGAGAACAAATGG - Intronic
940269795 2:151877748-151877770 CAAATGCTCTGAAGCCCAAGAGG + Intronic
941279692 2:163534680-163534702 CAGCTGCTCTGGAGGCTGAGAGG - Intergenic
944028251 2:195198599-195198621 CAGCTGCTCTGGAGGCTGAGGGG - Intergenic
947318493 2:228891203-228891225 CAAGTGTTCTGGTGGTCAAGAGG - Intronic
947348264 2:229216272-229216294 CTACAGCTGTGGAGGAGAAGTGG + Intronic
947855830 2:233323896-233323918 CAGATGCTGTGGAGAACAAGAGG + Intronic
948101009 2:235373320-235373342 CAGCTGCTCTGAAGACCAAGGGG - Intergenic
1168809568 20:695655-695677 CAACCACTCTGGAGAACAATTGG - Intergenic
1169049282 20:2562354-2562376 GAGCTGCTCTTGAGGAGAAGGGG - Intronic
1169275128 20:4228640-4228662 CAACTGCTCTGGAGAAGAAGGGG - Intronic
1170531003 20:17291614-17291636 CAATTGCTGTGGAGGACAATTGG - Intronic
1171988693 20:31678849-31678871 CAACAGCTCTGGAGGATTTGGGG + Intronic
1173271853 20:41543533-41543555 CATCTGATCTGGAGAACAAGTGG - Intronic
1174309009 20:49635898-49635920 CCTCTGCTCTGAAGGCCAAGAGG + Exonic
1175263018 20:57686564-57686586 CAACAGCTCTTTAGGACAGGTGG - Intronic
1178875365 21:36410074-36410096 CAGCTACTCTGGAGGATAGGAGG - Intronic
1179441353 21:41396739-41396761 CAATAGCACTGGAGGACATGAGG + Intronic
1179888458 21:44324476-44324498 TCACAGCTCTGGGGGACAAGGGG - Exonic
1180712918 22:17852004-17852026 ACTCTGCTCTGGAGGACAGGAGG - Intronic
1180977853 22:19860282-19860304 CAGCTGCTCGGGAGGCCGAGGGG - Intergenic
1181038931 22:20182877-20182899 ACACTGGGCTGGAGGACAAGGGG + Intergenic
1183407174 22:37636038-37636060 CAGCTGCTCAGGAGGCTAAGAGG - Intronic
1185174633 22:49316939-49316961 CAACTGCTTTGGAAAACAGGTGG - Intergenic
1185183617 22:49378948-49378970 CAAATGTTCTGAAGGACAATGGG + Intergenic
949321134 3:2811778-2811800 CAGCTGCTCTGGAGGCTGAGAGG - Intronic
949867143 3:8555407-8555429 CATCTGAGCTGGAGGACAGGAGG + Intronic
950018915 3:9772681-9772703 CAACAGTTTTGGAGGCCAAGGGG - Intronic
950296126 3:11832907-11832929 CAACTTCCTTGGAGAACAAGTGG - Intronic
950616661 3:14165395-14165417 CCCCAGCTCTGCAGGACAAGCGG + Intronic
954704740 3:52473410-52473432 AAACTGCTGGGGAGAACAAGGGG - Intronic
956014048 3:64862426-64862448 CAGCTACTCTGGAGGCCGAGTGG - Intergenic
956737861 3:72252300-72252322 CAGCAGCTCTGGAGGAGATGTGG - Intergenic
957820137 3:85362019-85362041 CAACAGCTCTGGAGGAGATTTGG + Intronic
959842311 3:110991781-110991803 CAATTCCACTGGAGGACAATTGG + Intergenic
959868827 3:111303222-111303244 TCACTGCTCTGGGGGAGAAGTGG - Intronic
960986486 3:123284464-123284486 AAGCTGCTCTGGAGTCCAAGTGG + Exonic
961853674 3:129847747-129847769 CAACTACTTTGGAAGACAATTGG - Intronic
962382781 3:134910860-134910882 CAACTGCACAGGAGGTCAAGGGG - Intronic
963348004 3:144119024-144119046 CAAATGCTGTGGAGCACAAAAGG + Intergenic
964462928 3:156956256-156956278 CAACTGCTGTTCAGGACCAGAGG - Intronic
966285407 3:178289303-178289325 AAACTGCTCTGGTGGTGAAGGGG - Intergenic
968518228 4:1023678-1023700 CAGCTCCTCTGGGGGTCAAGAGG + Exonic
968649567 4:1755123-1755145 CAACACCCCTGGAGGACACGGGG + Intergenic
968733749 4:2284618-2284640 CAACTCCTCTGGGGAACCAGAGG - Intronic
973740535 4:53915523-53915545 CAGCTGCTCTGGAGGCTGAGCGG + Intronic
976222473 4:82768792-82768814 TCAATGCTCTGGGGGACAAGAGG - Intronic
976547300 4:86351040-86351062 CAACTGCTAAGGAGGGTAAGTGG - Intronic
978718840 4:111879990-111880012 CAACTGCTATGGCTGACAAGAGG - Intergenic
979565141 4:122146148-122146170 CAACAGCTGGGGAGGCCAAGGGG - Intergenic
980561235 4:134479177-134479199 CAGCTACTCAGGAGGCCAAGTGG - Intergenic
983445242 4:167842309-167842331 AAATTGTTCTGGAGAACAAGAGG + Intergenic
984954433 4:185031513-185031535 CAGCTGCTTGGGAGAACAAGGGG + Intergenic
986396992 5:7341059-7341081 GAACTGCCCTGGTGGAAAAGGGG + Intergenic
987366347 5:17152475-17152497 CAGTTGCTCTGGAGGCCAGGCGG - Intronic
990488310 5:56280285-56280307 CTACTGCTCTGGAGCACAGAAGG + Intergenic
990978033 5:61576003-61576025 CAGCGGCTCAGGAGGCCAAGAGG + Intergenic
991030919 5:62081529-62081551 CAGATCCTCTGCAGGACAAGAGG + Intergenic
991668344 5:69022426-69022448 CAAAGGCTCTGGAGGAGAATTGG - Intergenic
994741605 5:103625983-103626005 CAATAGCTCTGGAATACAAGAGG + Intergenic
996433981 5:123414085-123414107 AAACTGTTCTCAAGGACAAGGGG + Intronic
997386031 5:133473512-133473534 CAACTGCTTAGGGGGTCAAGAGG + Intronic
999073693 5:148774762-148774784 TAACTGCTCTGGATGAAATGGGG + Intergenic
999369372 5:151044614-151044636 CAAATGTGCGGGAGGACAAGGGG + Intronic
999441126 5:151601694-151601716 CAACTGCTCTGAACTACCAGGGG - Intergenic
1001867066 5:175114967-175114989 CAACTTCTTAGAAGGACAAGTGG - Intergenic
1002424979 5:179169562-179169584 CAGATGCTCAGGAGGACAGGGGG + Intronic
1003212214 6:4078749-4078771 CCACAGCTCAGGAGGAAAAGGGG - Intronic
1004094563 6:12539753-12539775 TAAGTGCTATGGAGGTCAAGAGG + Intergenic
1004676570 6:17848677-17848699 CAGCTACTCAGGAGGCCAAGGGG - Intronic
1005777291 6:29148737-29148759 CAACCACTCTAGAGGACAACTGG - Intergenic
1005808272 6:29495330-29495352 CATCAGCTCTGAAGTACAAGAGG + Intergenic
1006200709 6:32287333-32287355 CAACTACTCAGGAGGCCAAATGG + Intergenic
1006277855 6:33020518-33020540 CAACTGCTTTGGAGAACAACAGG + Intergenic
1006398203 6:33800777-33800799 GAGCTGCTCTGCAGTACAAGAGG - Intronic
1006664353 6:35679889-35679911 CAATAGCTTTGGAGTACAAGTGG - Intronic
1008065508 6:47043646-47043668 CAGCTGGTGTGGAAGACAAGTGG - Intergenic
1008495058 6:52124774-52124796 CCTCTGCTCTGGAGAATAAGAGG - Intergenic
1009032885 6:58081519-58081541 CAACTGCACTGGAGGGGAAGAGG - Intergenic
1009208501 6:60833293-60833315 CAACTGCACTGGAGGGGAAGAGG - Intergenic
1009676232 6:66826022-66826044 CTAATGCTAGGGAGGACAAGGGG + Intergenic
1011547435 6:88496705-88496727 CAACCTCTCTGGAGAACAATTGG + Intergenic
1014778635 6:125538318-125538340 CAACTTTTCTGGAGGTCATGTGG + Intergenic
1014785933 6:125619347-125619369 CAACTGCTTTGGAAAACAATGGG + Intergenic
1015380703 6:132564245-132564267 TAACTGCTCTGGAGAACTTGGGG - Intergenic
1019486509 7:1291962-1291984 CAACTGCTGGGGAGGACAACTGG - Intergenic
1019597281 7:1864007-1864029 AAACTACTCTGGAGGAGCAGAGG + Intronic
1019763634 7:2832794-2832816 CAGCCGCTCTGGACGGCAAGGGG - Intronic
1022296776 7:29062999-29063021 TAACAGCACTGGAGGACCAGAGG + Intronic
1023592337 7:41793465-41793487 CAGCGGCTCAGGAGGCCAAGGGG + Intergenic
1025035858 7:55592160-55592182 CTACTGCCCTTGAGGACAATGGG - Intergenic
1027351198 7:77313295-77313317 CAAGTGCTTTGTAGGCCAAGTGG + Intronic
1028842929 7:95448256-95448278 TAACTACTCTGGAGGGCAATTGG - Intergenic
1029473749 7:100770594-100770616 CAACTACTTGGGAGGCCAAGGGG - Intronic
1033982254 7:147179845-147179867 TAAGTGATCTTGAGGACAAGAGG + Intronic
1035353962 7:158265992-158266014 CCCCTGGTCTGGAGGACCAGTGG + Intronic
1037624744 8:20596973-20596995 CAGCTACTCTGGAGGCCAAGTGG - Intergenic
1037896178 8:22657843-22657865 CAGCTGCTTTGGAGGGCATGGGG + Intronic
1037966537 8:23138390-23138412 CAAGAGCTATGGAGGACCAGAGG - Intronic
1038536458 8:28356658-28356680 CAACTTCTCTGGTGAGCAAGCGG - Exonic
1039084100 8:33762575-33762597 CAACTACTATGGAGGACAATTGG - Intergenic
1041094419 8:54334907-54334929 CAACTACTCAGGAGGCCGAGGGG + Intergenic
1044721413 8:95152690-95152712 CTACTTTTGTGGAGGACAAGAGG + Intronic
1045222356 8:100211545-100211567 CAGCTGCTCTGGAAGCTAAGGGG + Intronic
1045353629 8:101364990-101365012 CAGCTGCTCTGGAGGTTGAGCGG - Intergenic
1045476557 8:102557624-102557646 CAGCTTCTGTGGAGGTCAAGAGG + Intronic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1046780583 8:118210526-118210548 GCACTGCTCTGGAGGACAGCAGG - Intronic
1046834942 8:118789854-118789876 CAACTGCACTAGAGGACACATGG + Intergenic
1047241945 8:123098851-123098873 CAACTCCTCTGGAAGTCAACTGG - Intronic
1048040547 8:130723492-130723514 CAACCACTGTGGAAGACAAGTGG - Intergenic
1048400615 8:134065435-134065457 CAACTGGTCAGCAGGACAGGGGG + Intergenic
1049258081 8:141624540-141624562 CCTCTGCTCTGGAGCACACGGGG - Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049889199 9:52488-52510 CCACTGCCCTGGAGGACCAGGGG - Intergenic
1050206728 9:3204370-3204392 AACCTGCTTTGGAGGAGAAGTGG - Intergenic
1051508530 9:17851646-17851668 CAAGTGCTCTGCAGACCAAGAGG - Intergenic
1051632337 9:19151768-19151790 CAATTTCTCTGGATGGCAAGTGG - Intergenic
1052965524 9:34337814-34337836 CAGCTGCTCAGGAGGCTAAGGGG + Intronic
1053674038 9:40403920-40403942 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1053730684 9:41053773-41053795 CCACTGCCCTGGAGGACCAGGGG - Intergenic
1053923841 9:43030287-43030309 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1054385142 9:64543989-64544011 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1054510587 9:65972370-65972392 CAGCTACTCTGGGGGAAAAGAGG + Intergenic
1054697817 9:68378303-68378325 CCACTGCCCTGGAGGACCAGGGG + Exonic
1054942831 9:70762565-70762587 AAACTGCTCTCAAGGACCAGTGG + Intronic
1055211067 9:73792418-73792440 CAATGGTTCTGGATGACAAGAGG + Intergenic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1057845312 9:98518153-98518175 CAACTGCTCTGGAGGACAAGGGG - Intronic
1058838766 9:108884965-108884987 CAACTACTCTGGAGGCTGAGGGG + Intronic
1059855945 9:118397388-118397410 CAACAGATCTGGAGGGCACGGGG - Intergenic
1059868086 9:118539252-118539274 CATCTGGTATGGAGTACAAGGGG - Intergenic
1059908366 9:119013877-119013899 CAACTGCTATGGAGAACAAGTGG - Intergenic
1059996314 9:119913662-119913684 CAAATGATGAGGAGGACAAGGGG - Intergenic
1060412640 9:123410337-123410359 AAACTGCTTTGGGGGACAGGAGG - Intronic
1060419719 9:123459230-123459252 CAGCTGCTCTGGAGGACCTGGGG + Intronic
1062478518 9:136741160-136741182 CACGTGCTCTCGGGGACAAGGGG + Intronic
1185871431 X:3667959-3667981 TACCAGCTCTGGAGGGCAAGAGG - Intronic
1187857934 X:23655056-23655078 CAGTTGTGCTGGAGGACAAGGGG - Intergenic
1188190114 X:27162357-27162379 CAACTGCCCAGAAGGACATGAGG + Intergenic
1189804414 X:44720783-44720805 TGTCTGCTCTGGAGGACAAGCGG + Intergenic
1192302643 X:69921700-69921722 CAACTTCTCTGAAGGACAAGGGG - Intronic
1192431539 X:71115816-71115838 CAGCTACTCTGGAGGCCGAGGGG - Intergenic
1192718732 X:73669688-73669710 CAAATGGTCTGGAGGAGAAAGGG - Intronic
1195469687 X:105218644-105218666 CAAGTGCTCTGGAATACAAAGGG + Intronic
1196981801 X:121222494-121222516 CAAGGGCTGTGGAAGACAAGTGG + Intergenic
1197014764 X:121610058-121610080 TAAATGTTGTGGAGGACAAGTGG + Intergenic
1198466330 X:136907894-136907916 CAAGAGCTTTGGAGAACAAGAGG - Intergenic
1199489747 X:148385252-148385274 CACATGCTCTGGAGGAAAAATGG - Intergenic
1199621309 X:149704204-149704226 CAAATGCTGTGGAGGAGAGGTGG + Intronic
1200341357 X:155400465-155400487 GAACTGCTATTGAGGACAATAGG + Intergenic
1200393521 X:155968538-155968560 CAACTGCTCAGGAGGAAACAGGG - Intergenic
1200792680 Y:7313733-7313755 TAACACCTCTGGAGGGCAAGAGG + Intergenic
1202031576 Y:20580121-20580143 CAAGTTCTCTGGAGGATGAGGGG + Intronic