ID: 1057846206

View in Genome Browser
Species Human (GRCh38)
Location 9:98526679-98526701
Sequence CTTGTGTTGGTCACCATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057846206_1057846209 27 Left 1057846206 9:98526679-98526701 CCTAGAATGGTGACCAACACAAG 0: 1
1: 0
2: 2
3: 17
4: 184
Right 1057846209 9:98526729-98526751 TGAATGAATGTATTACCAAATGG No data
1057846206_1057846210 28 Left 1057846206 9:98526679-98526701 CCTAGAATGGTGACCAACACAAG 0: 1
1: 0
2: 2
3: 17
4: 184
Right 1057846210 9:98526730-98526752 GAATGAATGTATTACCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057846206 Original CRISPR CTTGTGTTGGTCACCATTCT AGG (reversed) Intronic
901008188 1:6181652-6181674 CCCTTGTTGGTCACCATTCATGG - Intronic
902731408 1:18372346-18372368 TTTGTGGTGGTCACTATTCCCGG - Intronic
904227375 1:29034243-29034265 CCTGTGTTGGACACTATTCTAGG + Intronic
904820007 1:33235887-33235909 CTTCTGTTGGTCAGGACTCTTGG + Intergenic
904902580 1:33869181-33869203 TTTGTGTTACTCATCATTCTAGG + Intronic
905488054 1:38320842-38320864 CTTGTGATGGTCACAGTTCAGGG - Intergenic
907372845 1:54014256-54014278 ATCGCCTTGGTCACCATTCTTGG - Exonic
907854738 1:58291564-58291586 TTTGTGTTAGACACCATTGTAGG - Intronic
909589117 1:77325609-77325631 CCTGTGCTGGTCTCCATTTTGGG + Intronic
910000897 1:82341000-82341022 CTTGTGTCTGTCACTGTTCTAGG + Intergenic
910599220 1:89012732-89012754 ATTTTGTTGGTCAACCTTCTTGG - Intronic
915123355 1:153646861-153646883 ATTGTCTTGGGCAACATTCTGGG + Intergenic
918246760 1:182667371-182667393 CTGGTGTTGGTACCCCTTCTGGG - Intronic
918302130 1:183214223-183214245 CTTGTGTCAGGCACCATGCTGGG + Intronic
920586297 1:207165631-207165653 GTTTTGTTGGCTACCATTCTTGG + Intergenic
920647436 1:207813912-207813934 CTTGTGCTGGTCACTTTTTTTGG - Intergenic
922365004 1:224855274-224855296 CTCGTGTCAGCCACCATTCTGGG - Intergenic
923830167 1:237546825-237546847 CATGTATTGGTCACTATTCTAGG + Intronic
924443334 1:244104741-244104763 TTTGTGTTGGGCACTGTTCTAGG - Intergenic
1063671130 10:8101092-8101114 ATTGTGTTGGGCACCATGCCGGG - Intergenic
1064111662 10:12545004-12545026 CTTCTGATGATCACCATTATTGG - Intronic
1064169485 10:13017724-13017746 CATGTGTTGGGCACTATTCCAGG + Intronic
1066307354 10:34158660-34158682 GTTGTGTTGGACAGCGTTCTAGG - Intronic
1067534683 10:47100187-47100209 TTTGTGCTGGGCACCAGTCTAGG + Intergenic
1067897368 10:50198602-50198624 GTTGAGTAGGTCAGCATTCTAGG - Intronic
1068835524 10:61548326-61548348 CTTGTGATGATGACCATTCTAGG - Intergenic
1071384757 10:85107995-85108017 CTTGAGTTTGCCACAATTCTTGG + Intergenic
1071850305 10:89562013-89562035 CTTGTATTCCTTACCATTCTGGG + Intergenic
1071982612 10:91018962-91018984 CTATTATTGGTCATCATTCTGGG - Intergenic
1072782001 10:98257701-98257723 CTCATGTTGGCAACCATTCTGGG + Exonic
1073204968 10:101764006-101764028 CATGTGCTGGGCACCATTATAGG + Intergenic
1075093639 10:119457177-119457199 CTTGGGCTGGTGACCATCCTAGG - Intronic
1079029481 11:16975916-16975938 TGTGTGTGGGTCCCCATTCTAGG + Intronic
1079157922 11:17965689-17965711 TTTGTGTTGGGCATTATTCTAGG - Intronic
1079903594 11:26219129-26219151 CTTTTTTTGGTCACAATTCATGG - Intergenic
1080624436 11:34015793-34015815 CTTGTGTTGGGCACTATTCTAGG + Intergenic
1080925116 11:36748198-36748220 CATGTGCTGGGCACCATTCTAGG - Intergenic
1081271871 11:41094772-41094794 TATGTGCTAGTCACCATTCTAGG - Intronic
1083365057 11:62137495-62137517 TTTGTGTTGGGCCCCATGCTGGG + Intronic
1084131132 11:67135742-67135764 CTTTTGATCATCACCATTCTTGG + Intronic
1087963069 11:104375991-104376013 CCTGCTTTGGTCCCCATTCTTGG + Intergenic
1088059074 11:105623523-105623545 TTTGTCTTGTTCACCATTCTGGG + Intronic
1088779681 11:113122401-113122423 CATGTGTCAGTCACCATTTTAGG - Intronic
1089945580 11:122469225-122469247 TTTCAGTAGGTCACCATTCTTGG + Intergenic
1091442617 12:523204-523226 CATCTGCTGGTCACGATTCTGGG - Intronic
1093495026 12:19746674-19746696 CTTGTATTGCTCATAATTCTGGG + Intergenic
1094271921 12:28626569-28626591 CTTGGGTTGTTCACCCTTTTAGG + Intergenic
1096363066 12:51004873-51004895 CTTCTGTTGGCCACCCTTGTGGG - Exonic
1099165171 12:79297067-79297089 CTTGTGTTGGCAAACATTCTGGG + Intronic
1101895551 12:108753877-108753899 TTTATGTAGCTCACCATTCTGGG - Intergenic
1103523850 12:121554092-121554114 CCGGTGTGGGTCACCATGCTTGG - Intronic
1105814310 13:24020457-24020479 TTTGAGTTGGAAACCATTCTTGG + Intronic
1107648791 13:42523306-42523328 CTTCTGCTTGCCACCATTCTGGG - Intergenic
1111029117 13:82572943-82572965 TTTGTGTGGGTCACTAGTCTGGG - Intergenic
1112974318 13:105298485-105298507 TTTTTGTTGGTCACAATTCCAGG - Intergenic
1115961344 14:38838066-38838088 CTCCTATTGGTCCCCATTCTGGG + Intergenic
1118496935 14:66316237-66316259 CTTGTGTGCATCACCACTCTGGG - Intergenic
1119473373 14:74912810-74912832 CTTGTGTTGGTTTCCATTAGAGG + Intronic
1121144575 14:91573350-91573372 CATGTGTTGGTCACTCTTTTAGG + Intergenic
1121331161 14:93050639-93050661 CTTGGATTTGTCACCTTTCTGGG - Intronic
1123854029 15:24388073-24388095 CAGGTGTTGGCCACCATGCTTGG + Intergenic
1123869987 15:24560700-24560722 CAGGTGTTGGCCACCATGCTTGG + Intergenic
1124460696 15:29888626-29888648 TTTGTGTTGCTCACCATTTTAGG - Intronic
1125370007 15:38965197-38965219 CTTGTGTTGTTTCCCATTTTAGG + Intergenic
1125804825 15:42484778-42484800 ATTGAGTTGGTCACTATTTTGGG - Intronic
1128754346 15:70171152-70171174 CAAGTGTAGGTCACCATACTAGG - Intergenic
1128976115 15:72155061-72155083 GTTGGGTTGGGCACCACTCTGGG - Intergenic
1130272580 15:82459709-82459731 CTTGTGTAAGTCACTTTTCTTGG + Intergenic
1130464932 15:84187062-84187084 CTTGTGTAAGTCACTTTTCTTGG + Intergenic
1130487756 15:84407742-84407764 CTTGTGTAAGTCACTTTTCTTGG - Intergenic
1130499333 15:84486475-84486497 CTTGTGTAAGTCACTTTTCTTGG - Intergenic
1130587222 15:85191676-85191698 CTTGTGTAAGTCACTTTTCTTGG + Intergenic
1132207110 15:99993797-99993819 CATGCGTCTGTCACCATTCTTGG - Intronic
1133015917 16:2940177-2940199 CTTTTGTGGGTCAACATTATGGG + Intronic
1135393348 16:22112251-22112273 CATGTATTGGTTACCATACTAGG + Intronic
1137860250 16:51839795-51839817 CTTGTGTCTGTCTCCCTTCTGGG - Intergenic
1138567140 16:57841802-57841824 CTTGTGTCTGTCACCATGCCAGG + Intronic
1139909351 16:70387803-70387825 CTGGTTTTGGTCTCCTTTCTGGG - Intronic
1141597417 16:85105967-85105989 CTTGGGTAAGTCACCTTTCTTGG + Intronic
1142696415 17:1636306-1636328 TTTGTGTTAGTCACTGTTCTTGG - Intronic
1144823637 17:18092886-18092908 CTAGAGCTGCTCACCATTCTGGG - Intronic
1146103349 17:30007707-30007729 CAGGTGTGGGTCACCACTCTGGG - Intronic
1146354032 17:32119181-32119203 TATGTGCTGGACACCATTCTAGG - Intergenic
1150570469 17:66382026-66382048 CCTCTGTTTGTCACCATTATGGG + Intronic
1151525938 17:74668009-74668031 CTTATCTTGGTGAGCATTCTAGG - Intergenic
1157264320 18:46204626-46204648 CTTGTGTTTCTTACAATTCTAGG + Intronic
1161211082 19:3066099-3066121 ATAGTGTGGGCCACCATTCTGGG - Intergenic
1162984808 19:14262892-14262914 CATGTGTGAGTCACCATTCCTGG - Intergenic
1163137559 19:15323762-15323784 CTTGTCTTGGTCTCCACTCAAGG - Intronic
1165134853 19:33661439-33661461 CTTGTGGAGGTCACCTTTATGGG + Intronic
1165312168 19:35035003-35035025 CTGGTGTTTGTCACGATGCTGGG + Intronic
1165724362 19:38102384-38102406 CTTGTGTTTGAGACCAGTCTGGG - Intronic
1166810849 19:45513911-45513933 TATGTGTTGGACGCCATTCTAGG + Intronic
925269448 2:2591883-2591905 CTTTTGGGGGTCACCATTCCAGG + Intergenic
927265239 2:21139884-21139906 CTTGTGTTGCTAAGTATTCTGGG + Exonic
930221778 2:48753450-48753472 CTTGTGAGGGTCACCACGCTTGG + Intronic
936577144 2:113666565-113666587 CCTGGGTTCCTCACCATTCTTGG + Intergenic
936818625 2:116490952-116490974 CTTCTGTGAGTCACGATTCTGGG - Intergenic
938214647 2:129500808-129500830 CTTGTGTGGCTCAGCTTTCTGGG - Intergenic
938639386 2:133264512-133264534 CATATGTTGGGCACCATTGTAGG - Intronic
940813273 2:158269704-158269726 ATTTTGTTGGTCACCACTATGGG - Intronic
941585676 2:167355054-167355076 CTTTTGTTGGTCTGCATTCATGG - Intergenic
943671638 2:190668099-190668121 CTAGTGTTGGTCAAGATTGTAGG + Intronic
944896617 2:204171999-204172021 CTGGTCTTGGTCATCCTTCTGGG + Intergenic
946056411 2:216906170-216906192 CTTCTGTGGGTCAGGATTCTGGG - Intergenic
946292762 2:218757812-218757834 CCTTTGTTGGTCACCTATCTTGG - Intergenic
946783452 2:223217716-223217738 CATGTGCTGGGTACCATTCTAGG - Intergenic
947078161 2:226366608-226366630 CTTGTGTAGGTCAGAATTCCAGG + Intergenic
1169227672 20:3866343-3866365 CTTGTGTGGGTCCCCGTCCTTGG + Exonic
1169492077 20:6079858-6079880 TCTGTGTTGGGCACCCTTCTAGG + Intronic
1171218354 20:23370146-23370168 CTTGTGTCCGTCATCGTTCTTGG - Exonic
1173696999 20:45026152-45026174 CATGTGTTTGACACTATTCTAGG + Intronic
1175470756 20:59225802-59225824 ATGGTGTGGGTTACCATTCTTGG + Intronic
1175521041 20:59603204-59603226 AGTGTGTTGGTGACCATTCTCGG + Intronic
1177200688 21:17952233-17952255 GCTGTGTTGGTCATCGTTCTTGG - Intronic
1178337181 21:31753844-31753866 TTTGTGTTGGGCAGCATTCAAGG + Intergenic
1180254898 21:46620170-46620192 CTTGTGAAGGTCACAATTCAAGG - Intergenic
1180696641 22:17755367-17755389 CTTCTCTGGGTCACCAATCTAGG - Intronic
1184407450 22:44308161-44308183 CCGATGTTGGTCCCCATTCTAGG - Intronic
1185423094 22:50746099-50746121 CCTGGGTTCCTCACCATTCTTGG - Intergenic
949946696 3:9195325-9195347 CTTGTGGTGGTCACGTTTTTAGG - Intronic
951834632 3:26968573-26968595 TTGTTCTTGGTCACCATTCTGGG - Intergenic
953507526 3:43500877-43500899 TTGTTGTTGATCACCATTCTAGG - Intronic
954005600 3:47588126-47588148 CTTGTGTTCCTCAACTTTCTTGG - Exonic
955531189 3:59874725-59874747 CCTGTGCTGGGCACCATGCTAGG + Intronic
957368441 3:79257848-79257870 CTTGTTTTAGTCATCATTTTTGG - Intronic
957742422 3:84288871-84288893 TTTGTGTTAGGCACCATGCTAGG - Intergenic
959485059 3:106918755-106918777 CTTGTGTTGGTATCCATGCTGGG - Intergenic
959494053 3:107028294-107028316 ATTCTATTTGTCACCATTCTAGG - Intergenic
959640273 3:108624149-108624171 CCTGTGTTGGTGACGATTGTTGG + Intronic
959712895 3:109402407-109402429 ATTGTATTGGTTAGCATTCTAGG - Intergenic
959750706 3:109831362-109831384 CATTTGTTTGTCACAATTCTGGG - Intergenic
960326867 3:116307426-116307448 CTTGGGTTGTTCAACATGCTGGG + Intronic
960675726 3:120192994-120193016 CTTGTGTTTGGCCCCATTCTGGG - Exonic
960969975 3:123132463-123132485 CTTGTTTTGGTCTCTTTTCTAGG - Intronic
962431865 3:135327570-135327592 CTTGAGCTGGTCACCACTGTTGG - Intergenic
966599392 3:181760474-181760496 CTTTTGTTAAGCACCATTCTAGG + Intergenic
969290599 4:6236818-6236840 CTGGCGTTGGTCACCATGCCTGG + Intergenic
970385135 4:15548398-15548420 CCTGTGCTGGTCACCATGCCTGG - Intronic
971177002 4:24291727-24291749 ATTTTGCTGGTCTCCATTCTGGG - Intergenic
975699784 4:77052448-77052470 CACCTGTTGGTCACCATTCTGGG - Intronic
975727946 4:77310321-77310343 CTTGTTTTGGTCAGCTTTGTCGG + Intronic
975988342 4:80228356-80228378 GTTGAGTTGGCCACCATTGTGGG + Intergenic
976565924 4:86550818-86550840 CGTGTGTTGGTCCACCTTCTAGG + Intronic
976770644 4:88648665-88648687 ATTTTGTTGGTCATTATTCTGGG + Intronic
978790229 4:112655608-112655630 CTTGTGTTAGGCACCATTCTTGG + Intronic
978880494 4:113696385-113696407 TATGTGTTAGACACCATTCTAGG - Intronic
978995838 4:115151205-115151227 CATGTGTAGGTCAACAGTCTGGG + Intergenic
979884844 4:126014015-126014037 GTTGTGTTAGTGACCATTTTAGG - Intergenic
980213840 4:129825340-129825362 CTTTTCTAGGTCATCATTCTAGG + Intergenic
981147773 4:141345370-141345392 TCTGTGTTGCCCACCATTCTGGG - Intergenic
985476590 5:83046-83068 TGTGTGCTGGGCACCATTCTAGG + Intergenic
985562243 5:594188-594210 CTGGTGTTGTCCACAATTCTGGG + Intergenic
990533843 5:56700667-56700689 CTAGTGTTAATCATCATTCTAGG + Intergenic
991426694 5:66499348-66499370 CTTGTGTCTGTCCCCATTCCTGG - Intergenic
992318496 5:75585360-75585382 TTTGTGTTAGGCACTATTCTAGG + Intronic
994063399 5:95506757-95506779 CTGGGGTTGGTTACCATTATAGG + Intronic
1000222313 5:159225566-159225588 TCTGTATTGGACACCATTCTAGG - Intergenic
1003876865 6:10445564-10445586 CTTTAATTGTTCACCATTCTGGG + Intergenic
1006527577 6:34620290-34620312 CTTGTGCCAGTCACCATCCTAGG - Intronic
1006733008 6:36250593-36250615 CTAGTGCTAGGCACCATTCTAGG + Intronic
1017558016 6:155593865-155593887 CTTATTTTGATCACTATTCTTGG - Intergenic
1018423977 6:163663579-163663601 CTCCTGATGGTCACCTTTCTGGG + Intergenic
1019302306 7:312083-312105 CTTGTGTCAGTCACGATACTTGG - Intergenic
1019501357 7:1366422-1366444 CTTGTGCTGGGCTCTATTCTAGG + Intergenic
1020288359 7:6703745-6703767 CATGTGTTGGTGTCCACTCTTGG - Intronic
1021652531 7:22846039-22846061 CTTCTGTTGGTCAGAAATCTGGG + Intergenic
1023770881 7:43555693-43555715 CTGGTGTCGGTCAGCATTCATGG + Intronic
1029272367 7:99384814-99384836 CATGTGCTGGACACCTTTCTAGG + Intronic
1030608765 7:111666721-111666743 CTTGTGTGTTTCACCATTCCTGG - Intergenic
1032885271 7:136131328-136131350 TTTGTGTTTGTCACCTGTCTGGG + Intergenic
1033104530 7:138508901-138508923 ATTGAGTTGGTCACCTATCTAGG + Intronic
1033266502 7:139891697-139891719 TATGTGTCAGTCACCATTCTAGG - Intronic
1033514637 7:142093933-142093955 TTTTTGTTTTTCACCATTCTTGG + Intronic
1035526708 8:318506-318528 CTTGTTTTGGTCCACATTGTAGG - Intergenic
1036821654 8:11944829-11944851 GTTGTGTTTGTGATCATTCTAGG - Intergenic
1037283043 8:17265006-17265028 CTTGTTTTAGCCACCATTCTTGG - Intronic
1038465617 8:27759952-27759974 CCTGAGTTGATCACCATTCCAGG - Intronic
1040418279 8:47215753-47215775 TTTGTGTTGCCCACCATCCTTGG + Intergenic
1043206984 8:77456931-77456953 CTTTTCTTGGTGACCATTCTAGG - Intergenic
1044874258 8:96648795-96648817 CTCTTGTTGTTCTCCATTCTTGG - Intronic
1045422406 8:102028922-102028944 TATGTGTTTGTCACCACTCTGGG - Intronic
1046869088 8:119184807-119184829 CTTGTGTTGCTCACAACTCAAGG + Intronic
1047435738 8:124834365-124834387 CCTGTGTTTGTAACCATTCTTGG + Intergenic
1057846206 9:98526679-98526701 CTTGTGTTGGTCACCATTCTAGG - Intronic
1059423877 9:114208961-114208983 CTGGGGCTCGTCACCATTCTGGG - Intronic
1060789234 9:126474709-126474731 CATGTGCTGGACACCATACTGGG + Intronic
1061562483 9:131414881-131414903 CTTCTGTTGGTCGTCATTCTGGG + Intronic
1186730158 X:12401473-12401495 CTTGTGTTGCTCCCCATTTCTGG + Intronic
1186922625 X:14298796-14298818 CAAGTGCTGGTCACCATTCATGG + Intergenic
1188587727 X:31798634-31798656 CTTGATCTGGGCACCATTCTAGG + Intronic
1194653112 X:96538928-96538950 CTTGTGTTAGTCAGGACTCTTGG - Intergenic
1195451888 X:105023537-105023559 TTTGTGTTGGACACTGTTCTAGG - Intronic
1196943718 X:120803296-120803318 CTTGGGTTGCTCAGTATTCTGGG + Intergenic
1198340665 X:135710545-135710567 TTAGTGTTGGTCTCCATTCCTGG + Intergenic
1198347301 X:135771183-135771205 TTAGTGTTGGTCTCCATTCCTGG - Intergenic
1198349207 X:135788444-135788466 TTAGTGTTGGTCTCCATTCCTGG - Intergenic
1198351112 X:135805717-135805739 TTAGTGTTGGTCTCCATTCCTGG - Intergenic
1198353019 X:135822982-135823004 TTAGTGTTGGTCTCCATTCCTGG - Intergenic
1198354928 X:135840237-135840259 TTAGTGTTGGTCTCCATTCCTGG - Intergenic
1198356838 X:135857520-135857542 TTAGTGTTGGTCTCCATTCCTGG - Intergenic
1198358751 X:135874799-135874821 TTAGTGTTGGTCTCCATTCCTGG - Intergenic
1202370304 Y:24191626-24191648 CTTGTGTAAGTCACCTTTCTTGG - Intergenic
1202500480 Y:25478491-25478513 CTTGTGTAAGTCACCTTTCTTGG + Intergenic