ID: 1057847697

View in Genome Browser
Species Human (GRCh38)
Location 9:98538321-98538343
Sequence TCTTTCATCCAGAGGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057847689_1057847697 15 Left 1057847689 9:98538283-98538305 CCTGGTACCAAATCCTTCCTTCT 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG No data
1057847690_1057847697 8 Left 1057847690 9:98538290-98538312 CCAAATCCTTCCTTCTTTTGTCT 0: 1
1: 0
2: 4
3: 99
4: 879
Right 1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG No data
1057847691_1057847697 2 Left 1057847691 9:98538296-98538318 CCTTCCTTCTTTTGTCTCATTTA 0: 1
1: 1
2: 3
3: 103
4: 1013
Right 1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG No data
1057847692_1057847697 -2 Left 1057847692 9:98538300-98538322 CCTTCTTTTGTCTCATTTACATC 0: 1
1: 0
2: 2
3: 33
4: 436
Right 1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG No data
1057847688_1057847697 18 Left 1057847688 9:98538280-98538302 CCACCTGGTACCAAATCCTTCCT 0: 1
1: 0
2: 0
3: 22
4: 184
Right 1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG No data
1057847687_1057847697 19 Left 1057847687 9:98538279-98538301 CCCACCTGGTACCAAATCCTTCC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057847697 Original CRISPR TCTTTCATCCAGAGGGGGCA TGG Intronic
No off target data available for this crispr