ID: 1057848017

View in Genome Browser
Species Human (GRCh38)
Location 9:98540344-98540366
Sequence GATTTTGGCAGAAGCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057848016_1057848017 -10 Left 1057848016 9:98540331-98540353 CCATTACTCATTGGATTTTGGCA 0: 1
1: 0
2: 1
3: 11
4: 172
Right 1057848017 9:98540344-98540366 GATTTTGGCAGAAGCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057848017 Original CRISPR GATTTTGGCAGAAGCCCTGC AGG Intronic
No off target data available for this crispr